hns:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hns |
|---|---|
| Mnemonic |
Histone-like protein H-NS |
| Synonyms |
ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1[1], fimG, H1, verA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
27.84 minutes |
MG1655: 1292145..1291732 |
||
|
NC_012967: 1292716..1292303 |
||||
|
NC_012759: 1181230..1181643 |
||||
|
W3110 |
|
W3110: 1294499..1294086 |
||
|
DH10B: 1332386..1331973 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1291735 |
Edman degradation |
PMID:2020545[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
hns(del) (Keio:JW1225) |
deletion |
deletion |
|||||
|
hns::Tn5KAN-2 (FB20271) |
Insertion at nt 323 in Plus orientation |
does not contain pKD46 | |||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
hns-206 |
|||||||
|
hns-1 |
|||||||
|
hns(del)-746::kan |
|||||||
|
hns |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
fig 2 | |||
|
hns-206::amp |
Auxotrophies |
Inactivation of hns strongly reduced the SOS induction of sbmC compared to the wild type, fig 1B. same applies to double mutant hns rpoS. |
|||||
|
bglY202 |
Carbon utilization |
Utilization of arbutin (a Beta-glucoside) as a carbon source, table 3. |
Experimental Strain: FA31 |
||||
|
bglY203 |
Carbon utilization |
able to utilize arbutin and salicin as a carbon source, table 3. |
FA35, FA37, FA39, FS20, FS29 |
Mutations also utilizing similar carbon sources are: bglY204, bglY205, bglY206, bglY207 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1225 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGAAGCACTTAAAATTCT Primer 2:CCTTGCTTGATCAGGAAATCGTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 5% [18] | ||
|
Linked marker |
est. P1 cotransduction: 66% [18] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kajitani, M & Ishihama, A (1991) Identification and sequence determination of the host factor gene for bacteriophage Q beta. Nucleic Acids Res. 19 1063-6 PubMed
- ↑ Yamada, H et al. (1990) An Escherichia coli protein that preferentially binds to sharply curved DNA. J. Biochem. 108 420-5 PubMed
- ↑ Laine, B et al. (1984) A DNA-binding protein from E. coli isolation, characterization and its relationship with proteins H1 and B1. Biochem. Biophys. Res. Commun. 119 1147-53 PubMed
- ↑ Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ 9.0 9.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 10.0 10.1 10.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 12.00 12.01 12.02 12.03 12.04 12.05 12.06 12.07 12.08 12.09 12.10 12.11 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ Oh, TJ et al. (2001) The Escherichia coli SOS gene sbmC is regulated by H-NS and RpoS during the SOS induction and stationary growth phase. Biochem. Biophys. Res. Commun. 288 1052-8 PubMed
- ↑ 15.0 15.1 Defez, R & De Felice, M (1981) Cryptic operon for beta-glucoside metabolism in Escherichia coli K12: genetic evidence for a regulatory protein. Genetics 97 11-25 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 17.0 17.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 18.0 18.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
