hns:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
hns |
|---|---|
| Gene Synonym(s) |
ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1[1], fimG, H1, verA |
| Product Desc. |
H-NS transcriptional dual regulator[2][3] DNA-binding global regulator H-NS; diverse mutant phenotypes affecting transcription, transposition, inversion, cryptic-gene expression; involved in chromosome organization; preferentially binds bent DNA; has N-terminal dimerization domain[4] |
| Product Synonyms(s) |
global DNA-binding transcriptional dual regulator H-NS[1], B1237[2][1], Irk[2][1], MsyA[2][1], PilG[2][1], TopS[2][1], TopX[2][1], VirR[2][1], Drs[2][1], Drc[2][1], Cur[2][1], Hns[2][1], DrdX[2][1], BglY[2][1], HnsA[2][1], DNA-binding protein HLP-II (HU, BH2, HD, NS); pleiotropic regulator[2][1], OsmZ[2][1], DNA-binding protein HLP-II (HU, BH2, HD, NS)[3][1] , B1, bglY, cur, drc, drdX, drs, ECK1232, fimG, H1, hnsA, irk, JW1225, msyA, osmZ, pilG, topS, topX, verA, virR, b1237 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HN-S forms heteromeric complexes with Hha and Cnu, which modulates HN-S function, expression and stability. Mutations affect chromosomal supercoiling. HT_Cmplx32_Mem: CspC+Hns+HupA.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hns |
|---|---|
| Mnemonic |
Histone-like protein H-NS |
| Synonyms |
ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1[1], fimG, H1, verA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
27.84 minutes |
MG1655: 1292145..1291732 |
||
|
NC_012967: 1292716..1292303 |
||||
|
NC_012759: 1181230..1181643 |
||||
|
W3110 |
|
W3110: 1294499..1294086 |
||
|
DH10B: 1332386..1331973 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1291735 |
Edman degradation |
PMID:2020545 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
hns(del) (Keio:JW1225) |
deletion |
deletion |
PMID:16738554 |
||||
|
hns::Tn5KAN-2 (FB20271) |
Insertion at nt 323 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
|
hns(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
|
hns-206 |
|||||||
|
hns-1 |
|||||||
|
hns(del)-746::kan |
PMID:16738554 |
||||||
|
hns |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
PMID:21357484 |
fig 2 | ||
|
hns-206::amp |
Auxotrophies |
Inactivation of hns strongly reduced the SOS induction of sbmC compared to the wild type, fig 1B. same applies to double mutant hns rpoS. |
PMID:11689018 |
||||
|
bglY202 |
Carbon utilization |
Utilization of arbutin (a Beta-glucoside) as a carbon source, table 3. |
PMID:6266910 |
Experimental Strain: FA31 |
|||
|
bglY203 |
Carbon utilization |
able to utilize arbutin and salicin as a carbon source, table 3. |
PMID:6266910 |
FA35, FA37, FA39, FS20, FS29 |
Mutations also utilizing similar carbon sources are: bglY204, bglY205, bglY206, bglY207 | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1225 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGCGAAGCACTTAAAATTCT Primer 2:CCTTGCTTGATCAGGAAATCGTC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 5% [6] | ||
|
Linked marker |
est. P1 cotransduction: 66% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000450 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0452 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0004152 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
Hns |
|---|---|
| Synonyms |
global DNA-binding transcriptional dual regulator H-NS[1], B1237[2][1], Irk[2][1], MsyA[2][1], PilG[2][1], TopS[2][1], TopX[2][1], VirR[2][1], Drs[2][1], Drc[2][1], Cur[2][1], Hns[2][1], DrdX[2][1], BglY[2][1], HnsA[2][1], DNA-binding protein HLP-II (HU, BH2, HD, NS); pleiotropic regulator[2][1], OsmZ[2][1], DNA-binding protein HLP-II (HU, BH2, HD, NS)[3][1] , B1, bglY, cur, drc, drdX, drs, ECK1232, fimG, H1, hnsA, irk, JW1225, msyA, osmZ, pilG, topS, topX, verA, virR, b1237 |
| Product description |
H-NS transcriptional dual regulator[2][3] DNA-binding global regulator H-NS; diverse mutant phenotypes affecting transcription, transposition, inversion, cryptic-gene expression; involved in chromosome organization; preferentially binds bent DNA; has N-terminal dimerization domain[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001801 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001801 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001801 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
|
GO:0003681 |
bent DNA binding |
PMID:10551881 |
IDA: Inferred from Direct Assay |
F |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
ssb |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
ymfG |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
stpA |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
sxy |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
prs |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
rplN |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
ruvC |
PMID:16606699 |
Experiment(s):EBI-1139271 | |
|
Protein |
aceE |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
ynbC |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
malP |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
malQ |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
rpoB |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-890481, EBI-895331 | |
|
Protein |
secA |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
tig |
PMID:15690043 |
Experiment(s):EBI-890481 | |
|
Protein |
cnu |
PMID:15690043 |
Experiment(s):EBI-895331 | |
|
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-895331 | |
|
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-895331 | |
|
Protein |
rplX |
PMID:15690043 |
Experiment(s):EBI-895331 | |
|
Protein |
stpA |
PMID:15690043 |
Experiment(s):EBI-895331 | |
|
Protein |
tig |
PMID:19402753 |
LCMS(ID Probability):97.9 MALDI(Z-score):36.434009 | |
|
Protein |
ssb |
PMID:19402753 |
MALDI(Z-score):29.456422 | |
|
Protein |
rplX |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
stpA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
cnu |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
HF-1 |
H-NS acts upstream or at the same level that HF-1 does; H-NS influences the expression or activity of HF-1 leading to affects in rpoStranslation |
PMID:8654929 |
there is no change in rpoS translation when there is an hns mutation when in and hfq mutant |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
cytoplasm |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSEALKILNN IRTLRAQARE CTLETLEEML EKLEVVVNER REEESAAAAE VEERTRKLQQ YREMLIADGI DPNELLNSLA AVKSGTKAKR AQRPAKYSYV DENGETKTWT GQGRTPAVIK KAMDEQGKSL DDFLIKQ |
| Length |
137 |
| Mol. Wt |
15.539 kDa |
| pI |
5.3 (calculated) |
| Extinction coefficient |
9,970 - 10,095 (calc based on 3 Y, 1 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0004152 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000450 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0452 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
2.32E+05 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 EMG2 |
820 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: Ml39 |
PMID: 9298646 |
|
Protein |
E. coli K-12 MG1655 |
86090 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
28848 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
38867 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1292125..1292165
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for hns | |
|
microarray |
Summary of data for hns from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to hns Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0452 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000450 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0004152 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
HNS |
From SHIGELLACYC |
|
E. coli O157 |
HNS |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10457 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000450 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0452 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0004152 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


