crp:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
crp |
|---|---|
| Mnemonic |
cAMP receptor protein |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
75.09 minutes, 75.09 minutes |
MG1655: 3484142..3484774 |
||
|
NC_012967: 3414025..3414657 |
||||
|
NC_012759: 3371299..3371931 |
||||
|
W3110 |
|
W3110: 4154296..4153664 |
||
|
DH10B: 3581887..3582519 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3484145 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
crpR181L |
R181L |
Suppresses DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR186K |
R186K |
No modification of DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR186L |
R186L |
Marginally reduced DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS129A |
S129A |
Reduced DNA-binding; no modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR181K |
R181K |
Suppresses DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS63A |
S63A |
Enhanced cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR83L |
R83L |
Loss of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS84A,K |
S84A,K |
No modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpT128A |
T128A |
No modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crp(del) (Keio:JW5702) |
deletion |
deletion |
|||||
|
crp::Tn5KAN-I-SceI (FB21127) |
Insertion at nt 369 in Minus orientation |
contains pKD46 | |||||
|
crp::Tn5KAN-I-SceI (FB21128) |
Insertion at nt 369 in Minus orientation |
does not contain pKD46 | |||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire N-Acetyl-D-glucosamine |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Fucose |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Maltose |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Sorbitol |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glycerol |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Gluconate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Serine |
||||
|
crp(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
crp-3(del) |
|||||||
|
crp-45(del) |
|||||||
|
crp-1 |
|||||||
|
crp-2 |
|||||||
|
crp-1004 |
|||||||
|
crp-39(del) |
|||||||
|
Δcrp-765::kan |
|||||||
|
crp(del) |
deletion |
deletion |
Auxotrophies |
Mutant unable to grow on MOPS minimal medium containing L-idonate, table 5. |
experimental strain: CB370 |
||
|
crp(del) |
deletion |
deletion |
Auxotrophies |
Mutant unable to grow on MOPS minimal medium containing L-idonate, table 5. |
experimental strain: CB370 |
||
|
crp(del) |
deletion |
deletion |
Auxotrophies |
Mutant unable to grow on MOPS minimal medium containing L-idonate, table 5. |
experimental strain: CB370 |
||
|
cya (del) crp (del) |
Sensitivity to |
sensitivity to streptozotocin |
Strain: CA8445 |
table 2 and figure 3 | |||
|
crp - relA + |
Resistant to |
Deficient mutants in relA backgroumd, were found to be resistant to smg (serine+methionine+glycine) |
table 4 | ||||
|
cya(del) crp* relA + |
Resistant to |
crp allele that modified cyclic AMP receptor proteins, which acts independently of cyclic AMP, is resistant to smg (serine+methionine+glycine) in a relA background. |
Experimental strain: BM6163 |
table 4 | |||
|
crp in mutant strain B1558 |
Resistant to |
Resistance to Beta Lactams |
Strain: B1558 |
Table 2 | |||
|
crp - |
Resistant to |
resistance to Mecillinam |
Strain: A060 |
Table 2B | |||
|
crp mutant in strain GC2846 |
Colony Morphology |
Mutatins causes spherical morphology. Wild Type is rod shaped. |
Strain: GC2846 |
See figure 1 | |||
|
Salmonella typhimurium LT2 crp-deficient |
Resistant to |
Partially resistant to 22 antibiotics (including fosfomycin, nalidixic acid, and streptomycin) |
|||||
|
crp in strain NCR-C51 |
Resistant to |
Resistance to Phage T6 |
Table 3 | ||||
|
crp-403 |
Resistant to |
Resistant to Fosfomycin |
Strain: TA3302 |
Parent Strain: LT2 Donor Strain: TA2305 | |||
|
crp-401 |
Spontaneous nonsense mutation |
Resistant to |
Resistant to Fosfomycin |
Strain: TA3339 |
Parent Strain: LT2 | ||
|
crp-401 |
Spontaneous nonsense mutation |
Resistant to |
Resistant to Streptomycin |
Strain:TA3339 |
Parent strain: LT2 | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5702 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCGTGCTTGGCAAACCGCAAAC Primer 2:CCACGAGTGCCGTAAACGACGAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 7% [18] | ||
|
Linked marker |
est. P1 cotransduction: 51% [18] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Aiba, H & Krakow, JS (1981) Isolation and characterization of the amino and carboxyl proximal fragments of the adenosine cyclic 3' ,5'-phosphate receptor protein of Escherichia coli. Biochemistry 20 4774-80 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 6.23 6.24 6.25 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 7.0 7.1 7.2 Bausch, C et al. (2004) Transcriptional organization and regulation of the L-idonic acid pathway (GntII system) in Escherichia coli. J. Bacteriol. 186 1388-97 PubMed
- ↑ Lengeler, J (1980) Characterisation of mutants of Escherichia coli K12, selected by resistance to streptozotocin. Mol. Gen. Genet. 179 49-54 PubMed
- ↑ 9.0 9.1 Daniel, J & Danchin, A (1979) Involvement of cyclic AMP and its receptor protein in the sensitivity of Escherichia coli K 12 toward serine: excretion of 2-ketobutyrate, a precursor of isoleucine. Mol. Gen. Genet. 176 343-50 PubMed
- ↑ Jaffé, A et al. (1983) Selection and characterization of beta-lactam-resistant Escherichia coli K-12 mutants. Antimicrob. Agents Chemother. 23 622-5 PubMed
- ↑ Aono, R et al. (1979) High and selective resistance to mecillinam in adenylate cyclase-deficient or cyclic adenosine 3',5'-monophosphate receptor protein-deficient mutants of Escherichia coli. J. Bacteriol. 137 839-45 PubMed
- ↑ D'Ari, R et al. (1988) Cyclic AMP and cell division in Escherichia coli. J. Bacteriol. 170 65-70 PubMed
- ↑ 13.0 13.1 13.2 13.3 Alper, MD & Ames, BN (1978) Transport of antibiotics and metabolite analogs by systems under cyclic AMP control: positive selection of Salmonella typhimurium cya and crp mutants. J. Bacteriol. 133 149-57 PubMed
- ↑ Alderman, EM et al. (1979) Cyclic adenosine 3',5'-monophosphate regulation of the bacteriophage T6/colicin K receptor in Escherichia coli. J. Bacteriol. 140 369-76 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 17.0 17.1 CGSC: The Coli Genetics Stock Center
- ↑ 18.0 18.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
