xerD:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
xerD |
|---|---|
| Gene Synonym(s) | |
| Product Desc. |
site-specific recombinase[3][4]; Component of Xer site-specific recombination system[4] Tyrosine recombinase XerCD resolves chromosome dimers; site-specific[5] |
| Product Synonyms(s) |
site-specific tyrosine recombinase[1], B2894[3][1], XprB[3][1], XerD[3][1] , ECK2889, JW2862, xprB, b2894 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
XerCD acts at the Dif site.[5]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
xerD |
|---|---|
| Mnemonic |
cer-specific recombination |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
65.45 minutes |
MG1655: 3037765..3036869 |
||
|
NC_012967: 2925496..2924600 |
||||
|
NC_012759: 2924017..2924913 |
||||
|
W3110 |
|
W3110: 3038399..3037503 |
||
|
DH10B: 3131635..3130739 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3036869 |
Edman degradation |
PMID:8402918 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔxerD (Keio:JW2862) |
deletion |
deletion |
PMID:16738554 |
||||
|
xerDR247Q |
R247Q |
Abolishes DNA cleavage activity |
|
seeded from UniProt:P0A8P8 | |||
|
xerDNHG256ESS |
NHG256ESS |
Abolishes plasmid resolution but not chromosomal recombination |
seeded from UniProt:P0A8P8 | ||||
|
xerDR148K |
R148K |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P8 | ||||
|
xerDH244L |
H244L |
Abolishes DNA religation activity |
seeded from UniProt:P0A8P8 | ||||
|
xerDA298Q |
A298Q |
Reduces chromosomal recombination but not plasmid resolution |
seeded from UniProt:P0A8P8 | ||||
|
xerDH295E |
H295E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDH294Q,E |
H294Q,E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDR297E |
R297E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDY279F |
Y279F |
Abolishes DNA cleavage activity |
|
seeded from UniProt:P0A8P8 | |||
|
ΔxerD745::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2862 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAACAGGATCTGGCACGCAT Primer 2:CCgGCCCGCGGGTGATGCTGTTG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: % [7] | ||
|
Linked marker |
est. P1 cotransduction: 11% [7] | ||
|
pRM130 |
Plasmid Clone |
XerD+ overexpressing plasmid |
PMID:8402918 |
|
pRM135 |
Plasmid Clone |
xerD+ overexpressing plasmid CmR, λdv replicon |
PMID:8402918 |
|
pLA123 |
Plasmid Clone |
XerDY280F overexpressing plasmid |
PMID:8402918 |
|
pLA127 |
Plasmid Clone |
XerDR247Q overexpressing plasmid |
PMID:8402918 |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001060 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1064 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009500 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
XerD |
|---|---|
| Synonyms |
site-specific tyrosine recombinase[1], B2894[3][1], XprB[3][1], XerD[3][1] , ECK2889, JW2862, xprB, b2894 |
| Product description |
site-specific recombinase[3][4]; Component of Xer site-specific recombination system[4] Tyrosine recombinase XerCD resolves chromosome dimers; site-specific[5] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
XerD binds to the dif right half site[8].
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002104 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004107 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
PMID:8402918 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013762 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01807 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01807 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002104 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013762 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0233 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006313 |
transposition, DNA-mediated |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01807 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0131 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007059 |
chromosome segregation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01807 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007059 |
chromosome segregation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007059 |
chromosome segregation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0159 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009037 |
tyrosine-based site-specific recombinase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01807 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015074 |
DNA integration |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002104 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015074 |
DNA integration |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004107 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015074 |
DNA integration |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015074 |
DNA integration |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013762 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015074 |
DNA integration |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0229 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051301 |
cell division |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011932 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051301 |
cell division |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0132 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048476 |
Holliday junction resolvase complex |
PMID:11114887 |
IDA: Inferred from Direct Assay |
C |
with XerC |
complete | ||
|
GO:0006276 |
plasmid maintenance |
PMID:8195072 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0009009 |
site-specific recombinase activity |
PMID:11114887 |
IDA: Inferred from Direct Assay |
F |
with XerC and FtsK |
complete | ||
|
GO:0009009 |
site-specific recombinase activity |
PMID:8402918 |
IDA: Inferred from Direct Assay |
F |
of cer and dif |
complete | ||
|
GO:0009037 |
tyrosine-based site-specific recombinase activity |
PMID:8402918 |
IMP: Inferred from Mutant Phenotype |
F |
complete | |||
|
GO:0071139 |
resolution of recombination intermediates |
PMID:7746851 |
IDA: Inferred from Direct Assay |
P |
complete | |||
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011010 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048476 |
Holliday junction resolvase complex |
PMID:7746851 |
IDA: Inferred from Direct Assay |
C |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of Xer site-specific recombination system |
could be indirect |
||
|
Protein |
rplQ |
PMID:16606699 |
Experiment(s):EBI-1144212 | |
|
Protein |
ytfN |
PMID:16606699 |
Experiment(s):EBI-1144212 | |
|
Protein |
rpsI |
PMID:16606699 |
Experiment(s):EBI-1144212 | |
|
Protein |
prs |
PMID:16606699 |
Experiment(s):EBI-1144212 | |
|
Protein |
acpP |
PMID:15690043 |
Experiment(s):EBI-884705 | |
|
Protein |
mukB |
PMID:15690043 |
Experiment(s):EBI-884705 | |
|
Protein |
acpP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
mukB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MKQDLARIEQ FLDALWLEKN LAENTLNAYR RDLSMMVEWL HHRGLTLATA QSDDLQALLA ERLEGGYKAT SSARLLSAVR RLFQYLYREK FREDDPSAHL ASPKLPQRLP KDLSEAQVER LLQAPLIDQP LELRDKAMLE VLYATGLRVS ELVGLTMSDI SLRQGVVRVI GKGNKERLVP LGEEAVYWLE TYLEHGRPWL LNGVSIDVLF PSQRAQQMTR QTFWHRIKHY AVLAGIDSEK LSPHVLRHAF ATHLLNHGAD LRVVQMLLGH SDLSTTQIYT HVATERLRQL HQQHHPRA |
| Length |
298 |
| Mol. Wt |
34.246 kDa |
| pI |
9.1 (calculated) |
| Extinction coefficient |
40,910 (calc based on 9 Y, 5 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Mutants that are still able to bind recombination sites, but do not promote recombination at cer or in vivo plasmid resolution
- Presumptive active site tyrosine nucleophile mutant = XerDY279F[9][10]
- Conserved Domain II Arginine implicated in DNA phosphodiester activation = XerDR247Q[11][10]
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0009500 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001060 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1064 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
199 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
73 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
103 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3037745..3037785
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for xerD | |
|
microarray |
Summary of data for xerD from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to xerD Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1064 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001060 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009500 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
XERD |
From SHIGELLACYC |
|
E. coli O157 |
XERD |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
XerD shares 37% identity with XerC[8].
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11071 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001060 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1064 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009500 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Member of the lambda integrase family of recombinases.
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Lovett, ST & Kolodner, RD (1991) Nucleotide sequence of the Escherichia coli recJ chromosomal region and construction of recJ-overexpression plasmids. J. Bacteriol. 173 353-64 PubMed
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 4.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 5.0 5.1 5.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 8.0 8.1 Blakely, G et al. (1993) Two related recombinases are required for site-specific recombination at dif and cer in E. coli K12. Cell 75 351-61 PubMed
- ↑ Pargellis, CA et al. (1988) Suicide recombination substrates yield covalent lambda integrase-DNA complexes and lead to identification of the active site tyrosine. J. Biol. Chem. 263 7678-85 PubMed
- ↑ 10.0 10.1 Leslie, NR & Sherratt, DJ (1995) Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. EMBO J. 14 1561-70 PubMed
- ↑ Parsons, RL et al. (1988) Step-arrest mutants of FLP recombinase: implications for the catalytic mechanism of DNA recombination. Mol. Cell. Biol. 8 3303-10 PubMed
Categories


