{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	xerD
Gene Synonym(s)	ECK2889, b2894, JW2862, xprB^[1]^[2], xprB
Product Desc.	site-specific recombinase^[3]^[4]; Component of Xer site-specific recombination system^[4] Tyrosine recombinase XerCD resolves chromosome dimers; site-specific^[5]
Product Synonyms(s)	site-specific tyrosine recombinase^[1], B2894^[3]^[1], XprB^[3]^[1], XerD^[3]^[1] , ECK2889, JW2862, xprB, b2894
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): xerD^[3]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

XerCD acts at the Dif site.^[5]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	xerD
Mnemonic	cer-specific recombination
Synonyms	ECK2889, b2894, JW2862, xprB^[1]^[2], xprB
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	65.45 minutes	MG1655: 3037765..3036869 <gbrowseImage> name=NC_000913:3036869..3037765 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2925496..2924600 <gbrowseImage> name=NC_012967:2924600..2925496 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2924017..2924913 <gbrowseImage> name=NC_012759:2924017..2924913 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3038399..3037503 <gbrowseImage> name=NC_007779:3037503..3038399 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3131635..3130739 <gbrowseImage> name=NC_010473:3130739..3131635 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3036869	Edman degradation	PMID:8402918
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
ΔxerD (Keio:JW2862)	deletion	deletion		PMID:16738554	Shigen CGSC10218^[6]
xerDR247Q		R247Q	Abolishes DNA cleavage activity	PMID:2974924 PMID:7729430		seeded from UniProt:P0A8P8
xerDNHG256ESS		NHG256ESS	Abolishes plasmid resolution but not chromosomal recombination			seeded from UniProt:P0A8P8
xerDR148K		R148K	Abolishes DNA cleavage activity			seeded from UniProt:P0A8P8
xerDH244L		H244L	Abolishes DNA religation activity			seeded from UniProt:P0A8P8
xerDA298Q		A298Q	Reduces chromosomal recombination but not plasmid resolution			seeded from UniProt:P0A8P8
xerDH295E		H295E	Abolishes DNA recombination (in vitro)			seeded from UniProt:P0A8P8
xerDH294Q,E		H294Q,E	Abolishes DNA recombination (in vitro)			seeded from UniProt:P0A8P8
xerDR297E		R297E	Abolishes DNA recombination (in vitro)			seeded from UniProt:P0A8P8
xerDY279F		Y279F	Abolishes DNA cleavage activity	PMID:2836392 PMID:7729430		seeded from UniProt:P0A8P8
ΔxerD745::kan				PMID:16738554	CGSC:103414
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2862	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAAACAGGATCTGGCACGCAT Primer 2:CCgGCCCGCGGGTGATGCTGTTG
22H4	Kohara Phage	Genobase	PMID:3038334
5E11	Kohara Phage	Genobase	PMID:3038334
recD1901::Tn10	Linked marker	CAG12135 = CGSC7429^[6]	est. P1 cotransduction: % ^[7]
speA210::Tn10	Linked marker	CAG12168 = CGSC7431^[6]	est. P1 cotransduction: 11% ^[7] Synonyms:zgd-210::Tn10, zgf-210::Tn10
pRM130	Plasmid Clone	XerD+ overexpressing plasmid	PMID:8402918
pRM135	Plasmid Clone	xerD+ overexpressing plasmid CmR, λdv replicon	PMID:8402918
pLA123	Plasmid Clone	XerDY280F overexpressing plasmid	PMID:8402918
pLA127	Plasmid Clone	XerDR247Q overexpressing plasmid	PMID:8402918
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11071	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11071	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001060	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947362	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1064	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009500	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	XerD
Synonyms	site-specific tyrosine recombinase^[1], B2894^[3]^[1], XprB^[3]^[1], XerD^[3]^[1] , ECK2889, JW2862, xprB, b2894
Product description	site-specific recombinase^[3]^[4]; Component of Xer site-specific recombination system^[4] Tyrosine recombinase XerCD resolves chromosome dimers; site-specific^[5]
EC number (for enzymes)
edit table

Notes

XerD binds to the dif right half site^[8].

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002104	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004107	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	PMID:8402918^[8]	IDA: Inferred from Direct Assay		F		complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013762	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01807	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01807	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002104	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013762	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0233	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006313	transposition, DNA-mediated	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01807	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007049	cell cycle	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007049	cell cycle	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0131	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007059	chromosome segregation	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01807	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007059	chromosome segregation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007059	chromosome segregation	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0159	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009037	tyrosine-based site-specific recombinase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01807	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015074	DNA integration	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002104	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015074	DNA integration	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004107	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015074	DNA integration	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015074	DNA integration	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013762	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015074	DNA integration	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0229	P	Seeded from EcoCyc (v14.0)	complete
	GO:0051301	cell division	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011932	P	Seeded from EcoCyc (v14.0)	complete
	GO:0051301	cell division	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0132	P	Seeded from EcoCyc (v14.0)	complete
	GO:0048476	Holliday junction resolvase complex	PMID:11114887^[9]	IDA: Inferred from Direct Assay		C	with XerC	complete
	GO:0006276	plasmid maintenance	PMID:8195072^[10]	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0009009	site-specific recombinase activity	PMID:11114887^[9]	IDA: Inferred from Direct Assay		F	with XerC and FtsK	complete
	GO:0009009	site-specific recombinase activity	PMID:8402918^[8]	IDA: Inferred from Direct Assay		F	of cer and dif	complete
	GO:0009037	tyrosine-based site-specific recombinase activity	PMID:8402918^[8]	IMP: Inferred from Mutant Phenotype		F		complete
	GO:0071139	resolution of recombination intermediates	PMID:7746851^[11]	IDA: Inferred from Direct Assay		P		complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011010	F	Seeded from EcoCyc (v14.0)	complete
	GO:0048476	Holliday junction resolvase complex	PMID:7746851^[11]	IDA: Inferred from Direct Assay		C		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of Xer site-specific recombination system	could be indirect
Protein	rplQ		PMID:16606699^[12]	Experiment(s):EBI-1144212
Protein	ytfN		PMID:16606699^[12]	Experiment(s):EBI-1144212
Protein	rpsI		PMID:16606699^[12]	Experiment(s):EBI-1144212
Protein	prs		PMID:16606699^[12]	Experiment(s):EBI-1144212
Protein	acpP		PMID:15690043^[13]	Experiment(s):EBI-884705
Protein	mukB		PMID:15690043^[13]	Experiment(s):EBI-884705
Protein	acpP		PMID:19402753^[14]	LCMS(ID Probability):99.6
Protein	mukB		PMID:19402753^[14]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MKQDLARIEQ FLDALWLEKN LAENTLNAYR RDLSMMVEWL HHRGLTLATA QSDDLQALLA ERLEGGYKAT SSARLLSAVR RLFQYLYREK FREDDPSAHL ASPKLPQRLP KDLSEAQVER LLQAPLIDQP LELRDKAMLE VLYATGLRVS ELVGLTMSDI SLRQGVVRVI GKGNKERLVP LGEEAVYWLE TYLEHGRPWL LNGVSIDVLF PSQRAQQMTR QTFWHRIKHY AVLAGIDSEK LSPHVLRHAF ATHLLNHGAD LRVVQMLLGH SDLSTTQIYT HVATERLRQL HQQHHPRA
Length	298
Mol. Wt	34.246 kDa
pI	9.1 (calculated)
Extinction coefficient	40,910 (calc based on 9 Y, 5 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	References
Domain	8..90	PF02899 Phage integrase, N-terminal SAM-like domain	PMID:19920124^[15]
Domain	111..286	PF00589 Phage integrase family	PMID:19920124^[15]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=xerD taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Mutants that are still able to bind recombination sites, but do not promote recombination at cer or in vivo plasmid resolution

Presumptive active site tyrosine nucleophile mutant = XerDY279F^[16]^[17]
Conserved Domain II Arginine implicated in DNA phosphodiester activation = XerDR247Q^[18]^[17]

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130796	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947362	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009500	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A8P8	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11071	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11071	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947362	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001060	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1064	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	199	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	73	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	103	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
xerD
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3037745..3037785 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2894 (EcoliWiki Page)	NCBI GEO profiles for xerD
microarray	GenExpDB:b2894 (EcoliWiki Page)	Summary of data for xerD from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to xerD Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11071	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1064	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2894
EcoGene	EcoGene:EG11071	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001060	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009500	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000026953 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000025093 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	XERD	From SHIGELLACYC
E. coli O157	XERD	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

XerD shares 37% identity with XerC^[8].

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF02899 Phage integrase, N-terminal SAM-like domain
Superfamily (EcoliWiki Page)	SUPERFAMILY:47823
Superfamily (EcoliWiki Page)	SUPERFAMILY:56349
Pfam (EcoliWiki Page)	PF00589 Phage integrase family
EcoCyc	EcoCyc:EG11071	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11071	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001060	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1064	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009500	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Member of the lambda integrase family of recombinases.

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 Lovett, ST & Kolodner, RD (1991) Nucleotide sequence of the Escherichia coli recJ chromosomal region and construction of recJ-overexpression plasmids. J. Bacteriol. 173 353-64 PubMed
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 ^3.7 ^3.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 ^4.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^5.0 ^5.1 ^5.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^6.0 ^6.1 ^6.2 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^8.0 ^8.1 ^8.2 ^8.3 ^8.4 Blakely, G et al. (1993) Two related recombinases are required for site-specific recombination at dif and cer in E. coli K12. Cell 75 351-61 PubMed
↑ ^9.0 ^9.1 Barre, FX et al. (2000) FtsK functions in the processing of a Holliday junction intermediate during bacterial chromosome segregation. Genes Dev. 14 2976-88 PubMed
↑ Cornet, F et al. (1994) Plasmid pSC101 harbors a recombination site, psi, which is able to resolve plasmid multimers and to substitute for the analogous chromosomal Escherichia coli site dif. J. Bacteriol. 176 3188-95 PubMed
↑ ^11.0 ^11.1 Sherratt, DJ et al. (1995) Site-specific recombination and circular chromosome segregation. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 347 37-42 PubMed
↑ ^12.0 ^12.1 ^12.2 ^12.3 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^13.0 ^13.1 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^14.0 ^14.1 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ ^15.0 ^15.1 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Pargellis, CA et al. (1988) Suicide recombination substrates yield covalent lambda integrase-DNA complexes and lead to identification of the active site tyrosine. J. Biol. Chem. 263 7678-85 PubMed
↑ ^17.0 ^17.1 Leslie, NR & Sherratt, DJ (1995) Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. EMBO J. 14 1561-70 PubMed
↑ Parsons, RL et al. (1988) Step-arrest mutants of FLP recombinase: implications for the catalytic mechanism of DNA recombination. Mol. Cell. Biol. 8 3303-10 PubMed

xerD:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to xerD Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search