xerD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
xerD |
|---|---|
| Mnemonic |
cer-specific recombination |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
65.45 minutes |
MG1655: 3037765..3036869 |
||
|
NC_012967: 2925496..2924600 |
||||
|
NC_012759: 2924017..2924913 |
||||
|
W3110 |
|
W3110: 3038399..3037503 |
||
|
DH10B: 3131635..3130739 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3036869 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔxerD (Keio:JW2862) |
deletion |
deletion |
|||||
|
xerDR247Q |
R247Q |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P8 | ||||
|
xerDNHG256ESS |
NHG256ESS |
Abolishes plasmid resolution but not chromosomal recombination |
seeded from UniProt:P0A8P8 | ||||
|
xerDR148K |
R148K |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P8 | ||||
|
xerDH244L |
H244L |
Abolishes DNA religation activity |
seeded from UniProt:P0A8P8 | ||||
|
xerDA298Q |
A298Q |
Reduces chromosomal recombination but not plasmid resolution |
seeded from UniProt:P0A8P8 | ||||
|
xerDH295E |
H295E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDH294Q,E |
H294Q,E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDR297E |
R297E |
Abolishes DNA recombination (in vitro) |
seeded from UniProt:P0A8P8 | ||||
|
xerDY279F |
Y279F |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P8 | ||||
|
ΔxerD745::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2862 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACAGGATCTGGCACGCAT Primer 2:CCgGCCCGCGGGTGATGCTGTTG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [11] | ||
|
Linked marker |
est. P1 cotransduction: 11% [11] | ||
|
pRM130 |
Plasmid Clone |
XerD+ overexpressing plasmid |
|
|
pRM135 |
Plasmid Clone |
xerD+ overexpressing plasmid CmR, λdv replicon |
|
|
pLA123 |
Plasmid Clone |
XerDY280F overexpressing plasmid |
|
|
pLA127 |
Plasmid Clone |
XerDR247Q overexpressing plasmid |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Lovett, ST & Kolodner, RD (1991) Nucleotide sequence of the Escherichia coli recJ chromosomal region and construction of recJ-overexpression plasmids. J. Bacteriol. 173 353-64 PubMed
- ↑ 3.0 3.1 3.2 3.3 3.4 Blakely, G et al. (1993) Two related recombinases are required for site-specific recombination at dif and cer in E. coli K12. Cell 75 351-61 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Parsons, RL et al. (1988) Step-arrest mutants of FLP recombinase: implications for the catalytic mechanism of DNA recombination. Mol. Cell. Biol. 8 3303-10 PubMed
- ↑ 7.0 7.1 Leslie, NR & Sherratt, DJ (1995) Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. EMBO J. 14 1561-70 PubMed
- ↑ Pargellis, CA et al. (1988) Suicide recombination substrates yield covalent lambda integrase-DNA complexes and lead to identification of the active site tyrosine. J. Biol. Chem. 263 7678-85 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
