tolC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tolC |
|---|---|
| Mnemonic |
Tolerance |
| Synonyms |
ECK3026, b3035, JW5503, colE1-i, mtcB, refI, weeA, mukA, toc[1], toc |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
68.46 minutes |
MG1655: 3176137..3177618 |
||
|
NC_012967: 3112287..3113768 |
||||
|
NC_012759: 3063285..3064766 |
||||
|
W3110 |
|
W3110: 3176771..3178252 |
||
|
DH10B: 3273882..3275363 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3176203 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔtolC (Keio:JW5503) |
deletion |
deletion |
|||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Glycerol |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire D-Serine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Inosine |
||||
|
ΔtolC::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
||||
|
tolC210::Tn10 |
Insertion at 3,176,395 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[7] |
Synonyms: | ||||
|
tolC3 |
|||||||
|
ΔtolC5 |
|||||||
|
tolC6::mini-Tn10 |
|||||||
|
tolC210::Tn10 |
|||||||
|
ΔtolC732::kan |
|||||||
|
mukA1 |
Growth Phenotype |
anucleate cells, slower growth, hypersensitivity to sodium dodecyl sulfate, tolerance to colicin E1 protein defective in locating replicated and decanted chromosomes |
|||||
|
tolC732::Kan |
Auxotrophies |
TolC was required for EXTREME-acid survival (pH 2) of strain W3110 grown aerobically to stationary phase. A tolC deletion decreased extreme-acid survival (acid resistance) of aerated pH 7.0-grown cells by 105-fold and of pH 5.5-grown cells by 10-fold. TolC was required for expression of glutamate decarboxylase (GadA, GadB), a key component of glutamate-dependent acid resistance (Gad). TolC was also required for maximal exponential growth of E. coli K-12 W3110, in LBK medium buffered at pH 4.5-6.0, but not at pH 6.5-8.5. The TolC growth requirement in moderate acid was independent of Gad. |
Parent:W3110 expiramental: JLS1-15 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5503 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAGAAATTGCTCCCCATTCT Primer 2:CCGTTACGGAAAGGGTTATGACC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 38% [7] | ||
|
Linked marker |
est. P1 cotransduction: 19% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Molloy, MP et al. (1998) Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 19 837-44 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 5.3 CGSC: The Coli Genetics Stock Center
- ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 7.0 7.1 7.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Whitney, EN (1971) The tolC locus in Escherichia coli K12. Genetics 67 39-53 PubMed
- ↑ Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ Hiraga, S et al. (1989) Chromosome partitioning in Escherichia coli: novel mutants producing anucleate cells. J. Bacteriol. 171 1496-505 PubMed
- ↑ Deininger, KN et al. (2011) A requirement of TolC and MDR efflux pumps for acid adaptation and GadAB induction in Escherichia coli. PLoS ONE 6 e18960 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
