rep:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rep |
|---|---|
| Mnemonic |
Replicase |
| Synonyms |
ECK3770, b3778, JW5604, dasC, mbrA, mmrA, dasC?[1][2], mmrA? |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.32 minutes |
MG1655: 3958700..3960721 |
||
|
NC_012967: 3922479..3924500 |
||||
|
NC_012759: 3848369..3850390 |
||||
|
W3110 |
|
W3110: 3676004..3673983 |
||
|
DH10B: 4057620..4059641 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3958700 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rep(del) (Keio:JW5604) |
deletion |
deletion |
|||||
|
rep::Tn5KAN-I-SceI (FB21451) |
Insertion at nt 508 in Minus orientation |
contains pKD46 | |||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
rep-5 |
|||||||
|
rep-3 |
|||||||
|
rep-142(ts) |
temperature sensitive |
||||||
|
[rep-71] |
null allele | ||||||
|
rep-729(del)::kan |
|||||||
|
rep in MDS42 |
deletion |
Sensitivity to |
increased sensitivity to Bicyclomycin |
Fig. 2 | |||
|
mbrA4 |
Growth Phenotype |
no growth in the first few hours at non-permissive conditions but eventually resumed growth, after exposed to LB cells began to elongate LB-Mac- |
|||||
|
mbrA15 |
Growth Phenotype |
temperature sensitive, forms two distinct populations, one more dense and one less dense than wild type |
|||||
|
mbrA4 |
Resistant to |
camphor resistance |
Table 2 and table 1 | ||||
|
mrbA15 |
Resistant to |
Resistant to camphor |
table 2 and table 1 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5604 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCCGTCTAAACCCCGGCCAACA Primer 2:CCTTTCCCTCGTTTTGCCGCCAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 83% [15] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 10% [15] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Bialkowska-Hobrzanska, H et al. (1985) Escherichia coli rep gene: identification of the promoter and N terminus of the rep protein. J. Bacteriol. 164 1004-10 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 6.3 6.4 6.5 6.6 6.7 6.8 6.9 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Takahashi, S et al. (1979) The rep mutation. VI. Purification and properties of the Escherichia coli rep protein, DNA helicase III. Can. J. Biochem. 57 855-66 PubMed
- ↑ Tessman, I et al. (1982) Relative map location of the rep and rho genes of Escherichia coli. J. Bacteriol. 151 1637-40 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ 10.0 10.1 10.2 10.3 Trun, NJ & Gottesman, S (1990) On the bacterial cell cycle: Escherichia coli mutants with altered ploidy. Genes Dev. 4 2036-47 PubMed
- ↑ 11.0 11.1 Trun, NJ & Gottesman, S () Characterization of Escherichia coli mutants with altered ploidy. Res. Microbiol. 142 195-200 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 CGSC: The Coli Genetics Stock Center
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
