crp:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
crp |
|---|---|
| Mnemonic |
cAMP receptor protein |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
75.09 minutes, 75.09 minutes |
MG1655: 3484142..3484774 |
||
|
NC_012967: 3414025..3414657 |
||||
|
W3110 |
|
W3110: 4154296..4153664 |
||
|
DH10B: 3581887..3582519 |
||||
|
NC_012759: 3371299..3371931 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
crpR181L |
R181L |
Suppresses DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR186K |
R186K |
No modification of DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR186L |
R186L |
Marginally reduced DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS129A |
S129A |
Reduced DNA-binding; no modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR181K |
R181K |
Suppresses DNA-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS63A |
S63A |
Enhanced cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpR83L |
R83L |
Loss of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpS84A,K |
S84A,K |
No modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
crpT128A |
T128A |
No modification of cAMP-binding |
seeded from UniProt:P0ACJ8 | ||||
|
Δcrp (Keio:JW5702) |
deletion |
deletion |
|||||
|
At position 369 in Minus orientation, contains plasmid pKD46. | |||||||
|
At position 369 in Minus orientation, does not contain plasmid pKD46. | |||||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire N-Acetyl-D-glucosamine |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire L-Fucose |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire Maltose |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Sorbitol |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire Glycerol |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Gluconate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
Δcrp-3 |
|||||||
|
Δcrp-45 |
|||||||
|
crp-1 |
|||||||
|
crp-2 |
|||||||
|
crp-1004 |
|||||||
|
Δcrp-39 |
|||||||
|
Δcrp-765::kan |
|||||||
|
Δcrp::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
| |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5702 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCGTGCTTGGCAAACCGCAAAC Primer 2:CCACGAGTGCCGTAAACGACGAT | |
|
Linked marker |
est. P1 cotransduction: 7% [8] | ||
|
Linked marker |
est. P1 cotransduction: 51% [8] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).