recA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
recA |
|---|---|
| Mnemonic |
Recombination |
| Synonyms |
ECK2694, b2699, JW2669, lexB, srf, umuB, zab, recH, rnmB, tif, umuR[1], umuR |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
60.8 minutes |
MG1655: 2821791..2820730 |
||
|
NC_012967: 2718628..2717567 |
||||
|
NC_012759: 2706542..2707603 |
||||
|
W3110 |
|
W3110: 2822425..2821364 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2820733 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
G161D |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
ΔrecA (Keio:JW2669) |
deletion |
deletion |
|||||
|
recA::Tn5KAN-I-SceI (FB20884) |
Insertion at nt 407 in Plus orientation |
does not contain pKD46 | |||||
|
recA::Tn5KAN-I-SceI (FB20885) |
Insertion at nt 407 in Plus orientation |
contains pKD46 | |||||
|
ΔrecA::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
ΔrecA::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
ΔrecA::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
recA938::Tn9-200 |
|||||||
|
recA1 |
|||||||
|
recA56 |
|||||||
|
recA13 |
|||||||
|
recA44(ts) |
temperature sensitive |
||||||
|
recA41 |
|||||||
|
recA441(ts) |
temperature sensitive |
||||||
|
recA430 |
|||||||
|
recA3 |
|||||||
|
recA11 |
|||||||
|
recA200(ts) |
temperature sensitive |
||||||
|
recA14 |
|||||||
|
recA12 |
|||||||
|
recA431 |
|||||||
|
recA34 |
|||||||
|
recA99(Am) |
amber (UAG) mutation | ||||||
|
recA142 |
|||||||
|
recA111 |
|||||||
|
recA629 |
|||||||
|
recA2111::RP4-2Tc::Mu |
|||||||
|
ΔrecA635::kan |
|||||||
|
ΔrecA636(del-ins)::FRT |
|||||||
|
recA2 |
|||||||
|
recA1907::cat-aadA |
|||||||
|
ΔrecA774::kan |
|||||||
|
recA730 |
constitutively activated form of RecA so it cleaves the LexA repressor in the absence of SOS induction |
||||||
|
recA |
deletion |
Sensitivity to |
increased sensitivity to Bicyclomycin |
fig 2 | |||
|
delta-recA |
The recA gene was deleted. |
Growth Phenotype |
When the recA gene was deleted there was only a marginal change in the growth rate compared to the wild type when exposed to the same concentration of levofloxacin. |
See figure 1. | |||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2669 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTATCGACGAAAACAAACA Primer 2:CCAAAATCTTCGTTAGTTTCTGC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [24] | ||
|
Linked marker |
est. P1 cotransduction: 85% [24] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Horii, T et al. (1980) Organization of the recA gene of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 77 313-7 PubMed
- ↑ Sancar, A et al. (1980) Sequences of the recA gene and protein. Proc. Natl. Acad. Sci. U.S.A. 77 2611-5 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 8.0 8.1 8.2 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 9.0 9.1 9.2 Kawashima, H et al. (1984) Functional domains of Escherichia coli recA protein deduced from the mutational sites in the gene. Mol. Gen. Genet. 193 288-92 PubMed
- ↑ 10.0 10.1 10.2 10.3 10.4 Templin, A et al. (1978) Suppressibility of recA, recB, and recC mutations by nonsense suppressors. J. Bacteriol. 134 590-6 PubMed
- ↑ 11.0 11.1 11.2 11.3 11.4 11.5 Dutreix, M et al. (1989) New recA mutations that dissociate the various RecA protein activities in Escherichia coli provide evidence for an additional role for RecA protein in UV mutagenesis. J. Bacteriol. 171 2415-23 PubMed
- ↑ Lavery, PE & Kowalczykowski, SC (1990) Properties of recA441 protein-catalyzed DNA strand exchange can be attributed to an enhanced ability to compete with SSB protein. J. Biol. Chem. 265 4004-10 PubMed
- ↑ Larminat, F et al. (1992) New mutations in and around the L2 disordered loop of the RecA protein modulate recombination and/or coprotease activity. J. Bacteriol. 174 6264-9 PubMed
- ↑ 14.0 14.1 Zaitsev, E et al. (1994) Nucleotide sequence between recA and alaSp in E. coli K12 and the sequence change in four recA mutations. Mutat. Res. 323 173-7 PubMed
- ↑ Fuerst, CR & Siminovitch, L (1965) Characterization of an unusual defective lysogenic strain of Escherichia coli K-12(lambda). Virology 27 449-51 PubMed
- ↑ Knight, KL et al. (1984) Identification of the amino acid substitutions in two mutant forms of the recA protein from Escherichia coli: recA441 and recA629. J. Biol. Chem. 259 11279-83 PubMed
- ↑ 17.0 17.1 Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed
- ↑ Wanner, BL & Boline, JA (1990) Mapping and molecular cloning of the phn (psiD) locus for phosphonate utilization in Escherichia coli. J. Bacteriol. 172 1186-96 PubMed
- ↑ Lin, LL & Little, JW (1988) Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 170 2163-73 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ Singh, R et al. (2010) Impact of recA on levofloxacin exposure-related resistance development. Antimicrob. Agents Chemother. 54 4262-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 24.0 24.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).