trpA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
trpA |
---|---|
Gene Synonym(s) |
ECK1254, b1260, JW1252, try, tryp[1], tryp |
Product Desc. |
tryptophan synthase, α subunit[2][3]; Component of tryptophan synthase[2][3] Tryptophan synthase, alpha subunit[4] |
Product Synonyms(s) |
tryptophan synthase, alpha subunit[1], B1260[2][1], Try[2][1], TrpA[2][1], α subunit[2][1], TSase α[2][1] , ECK1254, JW1252, try, tryp, b1260 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): trpCBA[2], trpLEDCBA[2], OP00094, trp |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
otherPDB (S. typhimurium): 1BKS.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
trpA |
---|---|
Mnemonic |
Tryptophan |
Synonyms |
ECK1254, b1260, JW1252, try, tryp[1], tryp |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
28.33 minutes |
MG1655: 1315246..1314440 |
||
NC_012967: 1314816..1314010 |
||||
NC_012759: 1205289..1206095 |
||||
W3110 |
|
W3110: 1318936..1318130 |
||
DH10B: 1404642..1403836 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1314440 |
Edman degradation |
PMID:388433 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
trpA(del) (Keio:JW1252) |
deletion |
deletion |
PMID:16738554 |
||||
trpA::Tn5KAN-2 (FB20276) |
Insertion at nt 549 in Minus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
trpALQGFGISAPDQVKAAI209IAGFWYFRPGSGKSSD |
LQGFGISAPDQVKAAI209IAGFWYFRPGSGKSSD |
(in mutant TrpA46-Asp-PR3) |
Strain variation; seeded from UniProt:P0A877 | ||||
trpA9605(Am) |
amber (UAG) mutation | ||||||
trpA49(Am) |
amber (UAG) mutation | ||||||
trpA33 |
|||||||
trpA43 |
|||||||
trpA9761(Am) |
amber (UAG) mutation | ||||||
trpA62 |
|||||||
trpA58 |
|||||||
trpA9825(Oc) |
ochre (UAA) mutation | ||||||
trpA36 |
|||||||
trpA23 |
PMID:13906503 PMID:13906211 PMID:13906504 |
||||||
trpA9705(Am) |
amber (UAG) mutation | ||||||
trpA9767 |
|||||||
trpA9607'(Oc, UAA15) |
PMID:14008999 |
ochre (UAA) mutation | |||||
trpA1016(Am, UAG15) |
amber (UAG) mutation | ||||||
trpA1017(UGA, UGA15) |
opal (UGA) mutation | ||||||
trpA1015'(Oc, UAA15) |
ochre (UAA) mutation | ||||||
trpA1049(Am, UAG49) |
amber (UAG) mutation | ||||||
trpA115(Am, UAG115) |
amber (UAG) mutation | ||||||
trpA116(UGA, UGA115) |
opal (UGA) mutation | ||||||
trpA102(Am, UAG102) |
amber (UAG) mutation | ||||||
trpA103(Oc, UAA102) |
ochre (UAA) mutation | ||||||
trpA104(UGA, UGA102) |
opal (UGA) mutation | ||||||
trpA212(Am, UAG211) |
amber (UAG) mutation | ||||||
trpA213(UGA, UGA211) |
opal (UGA) mutation | ||||||
trpA211(Oc, UAA211) |
ochre (UAA) mutation | ||||||
trpA236(Am, UAG234) |
amber (UAG) mutation | ||||||
trpA234(UGA, UGA234) |
opal (UGA) mutation | ||||||
trpA235(Oc, UAA234) |
ochre (UAA) mutation | ||||||
trpA244(Am, UAG243) |
amber (UAG) mutation | ||||||
trpA245(UGA, UGA243) |
opal (UGA) mutation | ||||||
trpA243(Oc, UAA243) |
ochre (UAA) mutation | ||||||
trpA768(del)::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1252 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGAACGCTACGAATCTCTGTT Primer 2:CCACTGCGCGTCGCCGCTTTCAT | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 69% [6] | ||
Linked marker |
est. P1 cotransduction: 90% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001013 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1017 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004232 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
TrpA |
---|---|
Synonyms |
tryptophan synthase, alpha subunit[1], B1260[2][1], Try[2][1], TrpA[2][1], α subunit[2][1], TSase α[2][1] , ECK1254, JW1252, try, tryp, b1260 |
Product description |
tryptophan synthase, α subunit[2][3]; Component of tryptophan synthase[2][3] Tryptophan synthase, alpha subunit[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000162 |
tryptophan biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00131 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000162 |
tryptophan biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0822 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011060 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013785 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004834 |
tryptophan synthase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00131 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004834 |
tryptophan synthase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002028 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004834 |
tryptophan synthase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:4.2.1.20 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005515 |
protein binding |
PMID:378665 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016829 |
lyase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0456 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043199 |
sulfate binding |
PMID:15451433 |
IPI: Inferred from Physical Interaction |
F |
Missing: with/from | |||
GO:0005515 |
protein binding |
PMID:378665 |
IDA: Inferred from Direct Assay |
F |
Tryptophan synthase is a heterotetramer (2 alpha subunits & 2 beta subunits) EcoliWiki:trpA|EcoliWiki:trpB
|
complete | ||
Contributes to |
GO:0004834 |
tryptophan synthase activity |
PMID:8463331 |
IDA: Inferred from Direct Assay |
F |
complete | ||
GO:0009073 |
aromatic amino acid family biosynthetic process |
PMID:8463331 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
GO:0000162 |
tryptophan biosynthetic process |
PMID:8463331 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
GO:0005737 |
cytoplasm |
PMID:4887511 |
IDA: Inferred from Direct Assay |
C |
complete | |||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of tryptophan synthase |
could be indirect |
||
Protein |
yciE |
PMID:16606699 |
Experiment(s):EBI-1139344 | |
Protein |
yhhY |
PMID:16606699 |
Experiment(s):EBI-1139344 | |
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1139344 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MERYESLFAQ LKERKEGAFV PFVTLGDPGI EQSLKIIDTL IEAGADALEL GIPFSDPLAD GPTIQNATLR AFAAGVTPAQ CFEMLALIRQ KHPTIPIGLL MYANLVFNKG IDEFYAQCEK VGVDSVLVAD VPVEESAPFR QAALRHNVAP IFICPPNADD DLLRQIASYG RGYTYLLSRA GVTGAENRAA LPLNHLVAKL KEYNAAPPLQ GFGISAPDQV KAAIDAGAAG AISGSAIVKI IEQHINEPEK MLAALKVFVQ PMKAATRS |
Length |
268 |
Mol. Wt |
28.724 kDa |
pI |
5.3 (calculated) |
Extinction coefficient |
10,430 - 10,805 (calc based on 7 Y, 0 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0004232 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001013 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1017 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
2.23E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 EMG2 |
280 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: M121 |
PMID: 9298646 |
Protein |
E. coli K-12 MG1655 |
544 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2506 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
653 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1315226..1315266
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for trpA | |
microarray |
Summary of data for trpA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to trpA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1017 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001013 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004232 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
TRPA |
From SHIGELLACYC |
E. coli O157 |
TRPA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11024 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001013 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1017 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004232 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories