trpA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
trpA |
|---|---|
| Mnemonic |
Tryptophan |
| Synonyms |
ECK1254, b1260, JW1252, try, tryp[1], tryp |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
28.33 minutes |
MG1655: 1315246..1314440 |
||
|
NC_012967: 1314816..1314010 |
||||
|
NC_012759: 1205289..1206095 |
||||
|
W3110 |
|
W3110: 1318936..1318130 |
||
|
DH10B: 1404642..1403836 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1314440 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
trpA(del) (Keio:JW1252) |
deletion |
deletion |
|||||
|
trpA::Tn5KAN-2 (FB20276) |
Insertion at nt 549 in Minus orientation |
does not contain pKD46 | |||||
|
trpALQGFGISAPDQVKAAI209IAGFWYFRPGSGKSSD |
LQGFGISAPDQVKAAI209IAGFWYFRPGSGKSSD |
(in mutant TrpA46-Asp-PR3) |
Strain variation; seeded from UniProt:P0A877 | ||||
|
trpA9605(Am) |
amber (UAG) mutation | ||||||
|
trpA49(Am) |
amber (UAG) mutation | ||||||
|
trpA33 |
|||||||
|
trpA43 |
|||||||
|
trpA9761(Am) |
amber (UAG) mutation | ||||||
|
trpA62 |
|||||||
|
trpA58 |
|||||||
|
trpA9825(Oc) |
ochre (UAA) mutation | ||||||
|
trpA36 |
|||||||
|
trpA23 |
|||||||
|
trpA9705(Am) |
amber (UAG) mutation | ||||||
|
trpA9767 |
|||||||
|
trpA9607'(Oc, UAA15) |
ochre (UAA) mutation | ||||||
|
trpA1016(Am, UAG15) |
amber (UAG) mutation | ||||||
|
trpA1017(UGA, UGA15) |
opal (UGA) mutation | ||||||
|
trpA1015'(Oc, UAA15) |
ochre (UAA) mutation | ||||||
|
trpA1049(Am, UAG49) |
amber (UAG) mutation | ||||||
|
trpA115(Am, UAG115) |
amber (UAG) mutation | ||||||
|
trpA116(UGA, UGA115) |
opal (UGA) mutation | ||||||
|
trpA102(Am, UAG102) |
amber (UAG) mutation | ||||||
|
trpA103(Oc, UAA102) |
ochre (UAA) mutation | ||||||
|
trpA104(UGA, UGA102) |
opal (UGA) mutation | ||||||
|
trpA212(Am, UAG211) |
amber (UAG) mutation | ||||||
|
trpA213(UGA, UGA211) |
opal (UGA) mutation | ||||||
|
trpA211(Oc, UAA211) |
ochre (UAA) mutation | ||||||
|
trpA236(Am, UAG234) |
amber (UAG) mutation | ||||||
|
trpA234(UGA, UGA234) |
opal (UGA) mutation | ||||||
|
trpA235(Oc, UAA234) |
ochre (UAA) mutation | ||||||
|
trpA244(Am, UAG243) |
amber (UAG) mutation | ||||||
|
trpA245(UGA, UGA243) |
opal (UGA) mutation | ||||||
|
trpA243(Oc, UAA243) |
ochre (UAA) mutation | ||||||
|
trpA768(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1252 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAACGCTACGAATCTCTGTT Primer 2:CCACTGCGCGTCGCCGCTTTCAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 69% [14] | ||
|
Linked marker |
est. P1 cotransduction: 90% [14] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Nichols, BP & Yanofsky, C (1979) Nucleotide sequences of trpA of Salmonella typhimurium and Escherichia coli: an evolutionary comparison. Proc. Natl. Acad. Sci. U.S.A. 76 5244-8 PubMed
- ↑ Guest, JR et al. (1967) The amino acid sequence of the A protein (alpha subunit) of the tryptophan synthetase of Escherichia coli. J. Biol. Chem. 242 5442-6 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ HENNING, U & YANOFSKY, C (1962) Amino acid replacements associated with reversion and recombination within the A gene. Proc. Natl. Acad. Sci. U.S.A. 48 1497-504 PubMed
- ↑ HELINSKI, DR & YANOFSKY, C (1962) Correspondence between genetic data and the position of amino acid alteration in a proein. Proc. Natl. Acad. Sci. U.S.A. 48 173-83 PubMed
- ↑ HENNING, U & YANOFSKY, C (1962) An alteration in the primary structure of a protein predicted on the basis of genetic recombination data. Proc. Natl. Acad. Sci. U.S.A. 48 183-90 PubMed
- ↑ YANOFSKY, C et al. (1961) The effects of mutation on the composition and properties of the A protein of Escherichia coli tryptohan synthetase. Cold Spring Harb. Symp. Quant. Biol. 26 11-24 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
