{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rpsQ
Gene Synonym(s)	ECK3298, b3311, JW3273, neaA, nea^[1]
Product Desc.	30S ribosomal subunit protein S17^[2]^[3]; Component of 30S ribosomal subunit^[2]^[3]; ribosome^[2]^[3] 30S ribosomal subunit protein S17^[4]
Product Synonyms(s)	30S ribosomal subunit protein S17^[1], B3311^[2]^[1], NeaA^[2]^[1], RpsQ^[2]^[1] , ECK3298, JW3273, neaA, b3311
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rpsJ-rplCDWB-rpsS-rplV-rpsC-rplP-rpmC-rpsQ^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

rpsQ can be deleted, but null mutants grow slowly and express kanamycin resistance weakly (Bubunenko, 2007), which may explain why a deletion was not isolated by Baba (2006), leading to its misclassification as an essential gene.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rpsQ
Mnemonic	Ribosomal protein, small
Synonyms	ECK3298, b3311, JW3273, neaA, nea^[1]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	74.28 minutes, 74.28 minutes	MG1655: 3446590..3446336 <gbrowseImage> name=NC_000913:3446336..3446590 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3376473..3376219 <gbrowseImage> name=NC_012967:3376219..3376473 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3333493..3333747 <gbrowseImage> name=NC_012759:3333493..3333747 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4191848..4192102 <gbrowseImage> name=NC_007779:4191848..4192102 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3544335..3544081 <gbrowseImage> name=NC_010473:3544081..3544335 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3446339	Edman degradation	PMID:344065 PMID:9868784 PMID:10739205
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
rpsQH31P		H31P		(in neamine-resistant mutant nea301)			Strain variation; seeded from UniProt:P0AG63
rpsQS68F		S68F		(prevents 30S subunit assembly at 42 degrees Celsius)			Strain variation; seeded from UniProt:P0AG63
neaA in strain K12-S			Resistant to	Resistant to Neamine	PMID:4604727	Strain K12-S as well as other strains are described in the first table	Table 1
neaA	nea301,nea302		Resistant to	Resistance to Neamine.	PMID:358966	Strain: K12S	This is a traceable author statement ^[5]
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3273	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCACCGATAAAATCCGTACTCT Primer 2:CCaAGAACCGCTTTCTCTACAAC
E1H9	Kohara Phage	Genobase	PMID:3038334
smg-3082::Tn10	Linked marker	CAG12071 = CGSC7444^[6]	est. P1 cotransduction: 53% ^[7] Synonyms:zhb-3082::Tn10, zhd-3082::Tn10
zhf-3084::Tn10	Linked marker	CAG18456 = CGSC7576^[6]	est. P1 cotransduction: 6% ^[7] Synonyms:zhe-3084::Tn10nnnCAG18456 also carries cysG0 (CGSC).
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10916	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10916	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000907	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947808	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0909	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010840	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RpsQ
Synonyms	30S ribosomal subunit protein S17^[1], B3311^[2]^[1], NeaA^[2]^[1], RpsQ^[2]^[1] , ECK3298, JW3273, neaA, b3311
Product description	30S ribosomal subunit protein S17^[2]^[3]; Component of 30S ribosomal subunit^[2]^[3]; ribosome^[2]^[3] 30S ribosomal subunit protein S17^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0022627	cytosolic small ribosomal subunit	PMID:4587209	IDA: Inferred from Direct Assay		C		complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000266	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR019979	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR019984	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01345	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000266	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR019979	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR019984	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019843	rRNA binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01345	F	Seeded from EcoCyc (v14.0)	complete
	GO:0019843	rRNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0699	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046677	response to antibiotic	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0046	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019843	rRNA binding	PMID:4598121	IDA: Inferred from Direct Assay		F		complete
	GO:0070181	SSU rRNA binding	PMID:4598121	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0070181	SSU rRNA binding	PMID:4598121	IDA: Inferred from Direct Assay		F	S17 is a primary binding protein which binds specifically to 16S rRNA in the absence of other ribosomal proteins.	complete
	GO:0046677	response to antibiotic	PMID:765484	IMP: Inferred from Mutant Phenotype		P	Certain mutations in rpsQ confer resistance to the aminoglycoside antibiotic neamine.	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References
Protein	Subunits of 30S ribosomal subunit	could be indirect
Protein	Subunits of ribosome	could be indirect
RNA	16S rRNA	S17 is a primary binding protein; it binds specifically to 16S rRNA in the absence of other ribosomal proteins.	PMID:4598121
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MTDKIRTLQG RVVSDKMEKS IVVAIERFVK HPIYGKFIKR TTKLHVHDEN NECGIGDVVE IRECRPLSKT KSWTLVRVVE KAVL
Length	84
Mol. Wt	9.703 kDa
pI	10.0 (calculated)
Extinction coefficient	6,990 - 7,240 (calc based on 1 Y, 1 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0AG63
Domain	10..78	PF00366 Ribosomal protein S17		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rpsQ taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131190	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947808	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010840	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AG63	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10916	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10916	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947808	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000907	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0909	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	9.52E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	118366	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	22711	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	92465	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rpsJ-rplCDWB-rpsS-rplV-rpsC-rplP-rpmC-rpsQ
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:3446570..3446610 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3311 (EcoliWiki Page)	NCBI GEO profiles for rpsQ
microarray	GenExpDB:b3311 (EcoliWiki Page)	Summary of data for rpsQ from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to rpsQ Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10916	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0909	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3311
EcoGene	EcoGene:EG10916	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000907	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010840	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Arabidopsis thaliana	AT1G49400 (score: 1.000; bootstrap: 84%) AT3G18880 (score: 0.623)	From Inparanoid:20070104
Oryza gramene	Q6YYA7 (score: 1.000; bootstrap: 93%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC1441 (score: 1.000; bootstrap: 100%) SPAC31G53 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	RPSQ	From SHIGELLACYC
E. coli O157	RPSQ	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:50249
Panther (EcoliWiki Page)	PTHR10744:SF1
Pfam (EcoliWiki Page)	PF00366 Ribosomal protein S17
EcoCyc	EcoCyc:EG10916	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10916	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000907	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0909	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010840	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Bollen, A et al. (1975) Alteration of ribosomal protein S17 by mutation linked to neamine resistance in Escherichia coli. I. General properties of neaA mutants. J. Mol. Biol. 99 795-806 PubMed
↑ ^6.0 ^6.1 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

rpsQ:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rpsQ Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search