rpsQ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
rpsQ |
---|---|
Mnemonic |
Ribosomal protein, small |
Synonyms |
ECK3298, b3311, JW3273, neaA, nea[1] |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
74.28 minutes, 74.28 minutes |
MG1655: 3446590..3446336 |
||
NC_012967: 3376473..3376219 |
||||
NC_012759: 3333493..3333747 |
||||
W3110 |
|
W3110: 4191848..4192102 |
||
DH10B: 3544335..3544081 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
3446339 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
rpsQH31P |
H31P |
(in neamine-resistant mutant nea301) |
Strain variation; seeded from UniProt:P0AG63 | ||||
rpsQS68F |
S68F |
(prevents 30S subunit assembly at 42 degrees Celsius) |
Strain variation; seeded from UniProt:P0AG63 | ||||
neaA in strain K12-S |
Resistant to |
Resistant to Neamine |
Strain K12-S as well as other strains are described in the first table |
Table 1 | |||
neaA |
nea301,nea302 |
Resistant to |
Resistance to Neamine. |
Strain: K12S |
This is a traceable author statement [7] | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3273 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCGATAAAATCCGTACTCT Primer 2:CCaAGAACCGCTTTCTCTACAAC | |
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 53% [11] | ||
Linked marker |
est. P1 cotransduction: 6% [11] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Yaguchi, M & Wittmann, HG (1978) The primary structure of protein S17 from the small ribosomal subunit of Escherichia coli. FEBS Lett. 87 37-40 PubMed
- ↑ Wasinger, VC & Humphery-Smith, I (1998) Small genes/gene-products in Escherichia coli K-12. FEMS Microbiol. Lett. 169 375-82 PubMed
- ↑ Hoving, S et al. (2000) A method for the chemical generation of N-terminal peptide sequence tags for rapid protein identification. Anal. Chem. 72 1006-14 PubMed
- ↑ Cannon, M et al. (1974) Mapping of neamine resistance: identification to two genetic loci, nea A and nea B. Mol. Gen. Genet. 130 321-6 PubMed
- ↑ Delcuve, G et al. (1978) Resistance to the aminoglycoside antibiotic neamine in Escherichia coli. A new mutant whose NeaR phenotype results from the cumulative effects of two distinct mutations. Biochem. J. 174 1-7 PubMed
- ↑ Bollen, A et al. (1975) Alteration of ribosomal protein S17 by mutation linked to neamine resistance in Escherichia coli. I. General properties of neaA mutants. J. Mol. Biol. 99 795-806 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).