rpsL:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
rpsL |
|---|---|
| Gene Synonym(s) |
ECK3329, b3342, JW3304, asuB, strA[1], strA |
| Product Desc. |
30S ribosomal subunit protein S12[2][3]; Component of 30S ribosomal subunit[2][3]; ribosome[2][3] 30S ribosomal subunit protein S12; RNA chaperone[4] |
| Product Synonyms(s) |
30S ribosomal subunit protein S12[1], B3342[2][1], StrA[2][1], AsuB[2][1], RpsL[2][1] , asuB, ECK3329, JW3304, strA, b3342 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rpsLG-fusA-tufA[2] |
| Regulation/Activity | |
| Quick Links |
|
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect> RpsL is a ribosomal gene that encodes the highly conserved rps12 protein of the ribosomal accuracy center in the Escherichia coli. Numerous mutations in the rpsL gene generate resistance to, and in some instances dependence on, high levels of streptomycin. [5]
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Toivonen, JM et al. (1999) Modelling in Escherichia coli of mutations in mitoribosomal protein S12: novel mutant phenotypes of rpsL. Mol. Microbiol. 31 1735-46 PubMed
</noinclude>
Mutations in regions 41-45 (except when lys42 is replaced with arg), 87-93 and 53 result in streptomycin resistance. A point mutation at 262 from A to G sustains protein synthesis in late stationary phase and increases the stability of the 70S complex in low magnesium concentrations.[1]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsL |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK3329, b3342, JW3304, asuB, strA[2], strA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.84 minutes |
MG1655: 3472574..3472200 |
||
|
NC_012967: 3402457..3402083 |
||||
|
NC_012759: 3359357..3359731 |
||||
|
W3110 |
|
W3110: 4165864..4166238 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3472203 |
Edman degradation |
PMID:320034 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
K43R |
Nonsynonomous mutation |
PMID:18245285 |
This is a SNP in E. coli K-12 Strain DH10B | |||
|
rpsLK43R |
K43R |
(confers streptomycin resistance but not hyperaccurate translation) |
Strain variation; seeded from UniProt:P0A7S3 | ||||
|
rpsLL57H |
L57H |
Protein is not incorporated into ribosomes |
seeded from UniProt:P0A7S3 | ||||
|
rpsLK88Q |
K88Q |
Confers low-level resistance to streptomycin and a 15% decrease in the translational elongation rate |
seeded from UniProt:P0A7S3 | ||||
|
rpsL136(strR) |
streptomycin resistant |
||||||
|
rpsL31(strR) |
streptomycin resistant |
||||||
|
rpsL8 |
|||||||
|
rpsL118(strR) |
streptomycin resistant |
||||||
|
rpsL200(strR) |
streptomycin resistant |
||||||
|
rpsL104 |
|||||||
|
rpsL109(strR) |
streptomycin resistant |
||||||
|
rpsL151(strR) |
streptomycin resistant |
||||||
|
rpsL195(strR) |
streptomycin resistant |
||||||
|
rpsL134(strR) |
streptomycin resistant |
||||||
|
rpsL175(strR) |
streptomycin resistant |
||||||
|
rpsL153(strR) |
streptomycin resistant |
||||||
|
rpsL67(strR) |
streptomycin resistant |
||||||
|
rpsL135(strR) |
streptomycin resistant |
||||||
|
rpsL125(strR) |
streptomycin resistant |
||||||
|
rpsL155(strR) |
streptomycin resistant |
||||||
|
rpsL150(strR) |
streptomycin resistant |
||||||
|
rpsL100(strR) |
streptomycin resistant |
||||||
|
rpsL181(strR) |
streptomycin resistant |
||||||
|
rpsL178(strR) |
streptomycin resistant |
||||||
|
rpsL172(strR) |
streptomycin resistant |
||||||
|
rpsL173(strR) |
streptomycin resistant |
||||||
|
rpsL223(strR) |
streptomycin resistant |
||||||
|
rpsL129(strR) |
streptomycin resistant |
||||||
|
rpsL99(strR) |
streptomycin resistant |
||||||
|
rpsL14 |
|||||||
|
rpsL700(strR) |
streptomycin resistant |
||||||
|
rpsL97(strR) |
streptomycin resistant |
||||||
|
rpsL78(strR) |
streptomycin resistant |
||||||
|
rpsL39(StrD) |
streptomycin dependent |
||||||
|
rpsL101(strR) |
streptomycin resistant |
||||||
|
rpsL45(strR) |
streptomycin resistant |
||||||
|
rpsL265(strR) |
streptomycin resistant |
||||||
|
rpsL704(strR) |
streptomycin resistant |
||||||
|
rpsL186(strR) |
streptomycin resistant |
||||||
|
rpsL17 |
|||||||
|
rpsL198(strR) |
streptomycin resistant |
||||||
|
rpsL197(strR) |
streptomycin resistant |
||||||
|
rpsL179(strR) |
streptomycin resistant |
||||||
|
rpsL117(strR) |
streptomycin resistant |
||||||
|
rpsL126(strR) |
streptomycin resistant |
||||||
|
rpsL25(strR) |
streptomycin resistant |
||||||
|
rpsL196(strR) |
streptomycin resistant |
||||||
|
rpsL213(strR) |
streptomycin resistant |
||||||
|
rpsL212(strR) |
streptomycin resistant |
PMID:1089639 PMID:1094452 |
|||||
|
rpsL124(strR) |
streptomycin resistant |
||||||
|
rpsL214(strR) |
streptomycin resistant |
||||||
|
rpsL228(strR) |
streptomycin resistant |
||||||
|
rpsL231(strR) |
streptomycin resistant |
||||||
|
rpsL999(strR) |
streptomycin resistant |
||||||
|
rpsL254(strR) |
streptomycin resistant |
||||||
|
rpsL255 |
|||||||
|
rpsL261(strR) |
streptomycin resistant |
||||||
|
rpsL35(strR) |
streptomycin resistant |
||||||
|
rpsL146(strR) |
streptomycin resistant |
||||||
|
rpsL110(strR) |
streptomycin resistant |
||||||
|
rpsL145(strR) |
streptomycin resistant |
||||||
|
rpsL257(strR) |
streptomycin resistant |
||||||
|
rpsL284(strR) |
streptomycin resistant |
||||||
|
rpsL283(strR) |
streptomycin resistant |
||||||
|
rpsL180(strR) |
streptomycin resistant |
||||||
|
rpsL182(strR) |
streptomycin resistant |
||||||
|
rpsL204(strR) |
streptomycin resistant |
||||||
|
[rpsL203](strR) |
streptomycin resistant |
||||||
|
rpsL160(strR) |
streptomycin resistant |
||||||
|
rpsL140(strR) |
streptomycin resistant |
||||||
|
rpsL149(strR) |
streptomycin resistant |
||||||
|
rpsL157(strR) |
streptomycin resistant |
||||||
|
rpsL115(strR) |
streptomycin resistant |
||||||
|
rpsL20(strR) |
streptomycin resistant |
||||||
|
rpsL62(strR) |
streptomycin resistant |
||||||
|
rpsL201(strR) |
streptomycin resistant |
||||||
|
rpsL192(strR) |
streptomycin resistant |
||||||
|
rpsL190(strR) |
streptomycin resistant |
||||||
|
rpsL194(strR) |
streptomycin resistant |
||||||
|
rpsL193(strR) |
streptomycin resistant |
||||||
|
rpsL56(strR) |
streptomycin resistant |
||||||
|
rpsL171(strR) |
streptomycin resistant |
||||||
|
rpsL230(strR) |
streptomycin resistant |
||||||
|
rpsL273(strR) |
streptomycin resistant |
||||||
|
rpsL132(strR) |
streptomycin resistant |
||||||
|
rpsL174(strR) |
streptomycin resistant |
||||||
|
rpsL159(strR) |
streptomycin resistant |
||||||
|
rpsL27(strR) |
streptomycin resistant |
||||||
|
rpsL138(strR) |
streptomycin resistant |
||||||
|
rpsL69(strR) |
streptomycin resistant |
||||||
|
rpsL71(strR) |
streptomycin resistant |
||||||
|
rpsL24(strR) |
streptomycin resistant |
||||||
|
rpsL281(strR) |
streptomycin resistant |
||||||
|
rpsL263(strR) |
streptomycin resistant |
||||||
|
rpsL185(strR) |
streptomycin resistant |
||||||
|
rpsL260(strR) |
streptomycin resistant |
||||||
|
rpsL154(strR) |
streptomycin resistant |
||||||
|
rpsL120(strR) |
streptomycin resistant |
||||||
|
rpsL264(strR) |
streptomycin resistant |
||||||
|
rpsL268(strR) |
streptomycin resistant |
||||||
|
rpsL127(strR) |
streptomycin resistant |
||||||
|
rpsL16(strR) |
streptomycin resistant |
||||||
|
rpsL712(strR) |
streptomycin resistant |
||||||
|
rpsL60(strR) |
streptomycin resistant |
||||||
|
rpsL106(strR) |
streptomycin resistant |
||||||
|
rpsL123(strR) |
streptomycin resistant |
||||||
|
rpsL144(strR) |
streptomycin resistant |
||||||
|
rpsL183(strR) |
streptomycin resistant |
||||||
|
rpsL133(strR) |
streptomycin resistant |
||||||
|
rpsL229(strR) |
streptomycin resistant |
||||||
|
rpsL227(strR) |
streptomycin resistant |
||||||
|
rpsL218(strR) |
streptomycin resistant |
||||||
|
rpsL217(strR) |
streptomycin resistant |
||||||
|
rpsL253(strR) |
streptomycin resistant |
||||||
|
rpsL272(strR) |
streptomycin resistant |
||||||
|
rpsL275(strR) |
streptomycin resistant |
||||||
|
rpsL252(strR) |
streptomycin resistant |
||||||
|
rpsL18(strR) |
streptomycin resistant |
||||||
|
rpsL38(strR) |
streptomycin resistant |
||||||
|
rpsL23(strR) |
streptomycin resistant |
||||||
|
rpsL112(strR) |
streptomycin resistant |
||||||
|
rpsL40 |
|||||||
|
rpsL30(strR) |
streptomycin resistant |
||||||
|
rpsL33(strR) |
streptomycin resistant |
||||||
|
rpsL114(strR) |
streptomycin resistant |
||||||
|
rpsL12(strR) |
streptomycin resistant |
||||||
|
rpsL143(strR) |
streptomycin resistant |
||||||
|
rpsL102(strR) |
streptomycin resistant |
||||||
|
rpsL119(strR) |
streptomycin resistant |
||||||
|
rpsL137(strR) |
streptomycin resistant |
||||||
|
rpsL139(strR) |
streptomycin resistant |
||||||
|
rpsL256(strR) |
streptomycin resistant |
||||||
|
rpsL184(strR) |
streptomycin resistant |
||||||
|
rpsL176(strR) |
streptomycin resistant |
||||||
|
rpsL199(strR) |
streptomycin resistant |
||||||
|
rpsL262(strR) |
streptomycin resistant |
||||||
|
rpsL58(strR) |
streptomycin resistant |
||||||
|
rpsL90(strR) |
streptomycin resistant |
||||||
|
rpsL219(strR) |
streptomycin resistant |
||||||
|
rpsL61(strR) |
streptomycin resistant |
||||||
|
rpsL91(strR) |
streptomycin resistant |
||||||
|
rpsL93(strR) |
streptomycin resistant |
||||||
|
rpsL94(strR) |
streptomycin resistant |
||||||
|
rpsL95(strR) |
streptomycin resistant |
||||||
|
rpsL128(strR) |
streptomycin resistant |
||||||
|
rpsL215(strR) |
streptomycin resistant |
||||||
|
rpsL221(strR) |
streptomycin resistant |
||||||
|
rpsL222(strR) |
streptomycin resistant |
||||||
|
rpsL224(strR) |
streptomycin resistant |
||||||
|
rpsL226(strR) |
streptomycin resistant |
||||||
|
rpsL290(strR) |
streptomycin resistant |
||||||
|
rpsL267(strR) |
streptomycin resistant |
||||||
|
rpsL321 |
|||||||
|
rpsL286 |
|||||||
|
rpsL9 |
|||||||
|
SmR in UK325 |
Streptomycin resistance was introduced to protein S12 (rpsL) |
Sensitivity to |
Altered activity toward Dimethyl Sulfate at position A908 |
PMID:2477554 |
Mutation also in strains Uk326, UK327 & UK235. See figure 2a. | ||
|
rpsL4 SmD in EB30 |
Streptomycin dependence was introduced into protein S12. |
Sensitivity to |
Reduced sensitivity toward DMS at positions A908 and A909 |
PMID:2477554 |
See figure 2A | ||
|
rpsL4 SmD in EB30 |
Addition of SmD into the S12 gene |
Sensitivity to |
After the addition of SmD there is reduced reactivity toward dimethyl sulfate at position A1413 |
PMID:2477554 |
See Figure 2b | ||
|
rpsL4 SmD in EB30 |
Introduction of SmD into protein S12 |
Sensitivity to |
Reduced reactivity toward kethoxal at position G1487 after the introduction of SmD |
PMID:2477224 |
See Figure 2C | ||
|
rpsL1rpsD2 |
Insertion of SmI into the rpsL and rpsD alleles |
Sensitivity to |
Insertion of streptomycin independence into both the rpsL and rpsD induced significantly greater reactivity with DMS at position A26. |
PMID:2477554 |
See Figure 1 for the Autoradiograph | ||
|
rpsL1, rpsD4 |
Insertion of SmI into the rpsL and rpsD alleles |
Sensitivity to |
Insertion of streptomycin independence into both the rpsL and rpsD induced significantly greater reactivity with DMS at position A8. |
PMID:2477554 |
See Figure 1 for the Autoradiograph | ||
|
glnV44 rpsL-asuB3 |
Insertion of anti-suppressor genes. |
Suppressor efficiency |
Decrease in suppressor efficiency |
PMID:3918006 |
See table 5 for results of suppressor efficiency test. | ||
|
spcA strA |
Resistant to |
Resistant to Neamine |
PMID:58966 |
Strain:KMBL-146 |
Table 4 results are traceable references here [3] | ||
|
rpsE-nea319 rpsL-nea319 |
Resistant to |
resistance to neamine |
PMID:765736 |
See Figure 7 for analysis of double mutation | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3304 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCAACAGTTAACCAGCTGGT Primer 2:CCAGCCTTAGGACGCTTCACGCC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 15% [6] | ||
|
Linked marker |
est. P1 cotransduction: 30% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000902 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0904 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0010919 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RpsL |
|---|---|
| Synonyms |
30S ribosomal subunit protein S12[2], B3342[7][2], StrA[7][2], AsuB[7][2], RpsL[7][2] , asuB, ECK3329, JW3304, strA, b3342 |
| Product description |
30S ribosomal subunit protein S12[7][8]; Component of 30S ribosomal subunit[7][8]; ribosome[7][8] 30S ribosomal subunit protein S12; RNA chaperone[1] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000049 |
tRNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0820 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005679 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006032 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00403 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0022627 |
cytosolic small ribosomal subunit |
PMID:4587209 |
IDA: Inferred from Direct Assay |
C |
complete | |||
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005679 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006032 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019843 |
rRNA binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00403 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019843 |
rRNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0699 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046677 |
response to antibiotic |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0046 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of 30S ribosomal subunit |
could be indirect |
||
|
Protein |
ycgL |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
hns |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
yedI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplO |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplA |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rpsI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
cspI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
yedN |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
Subunits of ribosome |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
cytoplasm |
From EcoCyc[8] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MATVNQLVRK PRARKVAKSN VPALEACPQK RGVCTRVYTT TPKKPNSALR KVCRVRLTNG FEVTSYIGGE GHNLQEHSVI LIRGGRVKDL PGVRYHTVRG ALDCSGVKDR KQARSKYGVK RPKA |
| Length |
124 |
| Mol. Wt |
13.736 kDa |
| pI |
11.3 (calculated) |
| Extinction coefficient |
5,960 - 6,460 (calc based on 4 Y, 0 W, and 4 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0010919 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000902 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0904 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
6.10E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
138745 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
31150 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
84361 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
 Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3472554..3472594
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rpsL | |
|
microarray |
Summary of data for rpsL from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (3472090..3472326) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to rpsL Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0904 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000902 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0010919 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
RPSL |
From SHIGELLACYC |
|
E. coli O157 |
RPSL |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10911 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000902 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0904 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0010919 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ De Wilde, M et al. (1975) Cooperative control of translation fidelity by ribosomal proteins in Escherichia coli. I. Properties of ribosomal mutants whose resistance to neamine is the cumulative effect of two distinct mutations. Mol. Gen. Genet. 142 19-33 PubMed
- ↑ 4.0 4.1 Yaguchi, M et al. (1975) Cooperative control of translational fidelity by ribosomal proteins in Escherichia coli. II. Localization of amino acid replacements in proteins S5 and S12 altered in double mutants resistant to neamine. Mol. Gen. Genet. 142 35-43 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 8.0 8.1 8.2 8.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157
