rpsL:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsL |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK3329, b3342, JW3304, asuB, strA[1], strA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.84 minutes |
MG1655: 3472574..3472200 |
||
|
NC_012967: 3402457..3402083 |
||||
|
NC_012759: 3359357..3359731 |
||||
|
W3110 |
|
W3110: 4165864..4166238 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3472203 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
K43R |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
rpsLK43R |
K43R |
(confers streptomycin resistance but not hyperaccurate translation) |
Strain variation; seeded from UniProt:P0A7S3 | ||||
|
rpsLL57H |
L57H |
Protein is not incorporated into ribosomes |
seeded from UniProt:P0A7S3 | ||||
|
rpsLK88Q |
K88Q |
Confers low-level resistance to streptomycin and a 15% decrease in the translational elongation rate |
seeded from UniProt:P0A7S3 | ||||
|
rpsL136(strR) |
streptomycin resistant |
||||||
|
rpsL31(strR) |
streptomycin resistant |
||||||
|
rpsL8 |
|||||||
|
rpsL118(strR) |
streptomycin resistant |
||||||
|
rpsL200(strR) |
streptomycin resistant |
||||||
|
rpsL104 |
|||||||
|
rpsL109(strR) |
streptomycin resistant |
||||||
|
rpsL151(strR) |
streptomycin resistant |
||||||
|
rpsL195(strR) |
streptomycin resistant |
||||||
|
rpsL134(strR) |
streptomycin resistant |
||||||
|
rpsL175(strR) |
streptomycin resistant |
||||||
|
rpsL153(strR) |
streptomycin resistant |
||||||
|
rpsL67(strR) |
streptomycin resistant |
||||||
|
rpsL135(strR) |
streptomycin resistant |
||||||
|
rpsL125(strR) |
streptomycin resistant |
||||||
|
rpsL155(strR) |
streptomycin resistant |
||||||
|
rpsL150(strR) |
streptomycin resistant |
||||||
|
rpsL100(strR) |
streptomycin resistant |
||||||
|
rpsL181(strR) |
streptomycin resistant |
||||||
|
rpsL178(strR) |
streptomycin resistant |
||||||
|
rpsL172(strR) |
streptomycin resistant |
||||||
|
rpsL173(strR) |
streptomycin resistant |
||||||
|
rpsL223(strR) |
streptomycin resistant |
||||||
|
rpsL129(strR) |
streptomycin resistant |
||||||
|
rpsL99(strR) |
streptomycin resistant |
||||||
|
rpsL14 |
|||||||
|
rpsL700(strR) |
streptomycin resistant |
||||||
|
rpsL97(strR) |
streptomycin resistant |
||||||
|
rpsL78(strR) |
streptomycin resistant |
||||||
|
rpsL39(StrD) |
streptomycin dependent |
||||||
|
rpsL101(strR) |
streptomycin resistant |
||||||
|
rpsL45(strR) |
streptomycin resistant |
||||||
|
rpsL265(strR) |
streptomycin resistant |
||||||
|
rpsL704(strR) |
streptomycin resistant |
||||||
|
rpsL186(strR) |
streptomycin resistant |
||||||
|
rpsL17 |
|||||||
|
rpsL198(strR) |
streptomycin resistant |
||||||
|
rpsL197(strR) |
streptomycin resistant |
||||||
|
rpsL179(strR) |
streptomycin resistant |
||||||
|
rpsL117(strR) |
streptomycin resistant |
||||||
|
rpsL126(strR) |
streptomycin resistant |
||||||
|
rpsL25(strR) |
streptomycin resistant |
||||||
|
rpsL196(strR) |
streptomycin resistant |
||||||
|
rpsL213(strR) |
streptomycin resistant |
||||||
|
rpsL212(strR) |
streptomycin resistant |
||||||
|
rpsL124(strR) |
streptomycin resistant |
||||||
|
rpsL214(strR) |
streptomycin resistant |
||||||
|
rpsL228(strR) |
streptomycin resistant |
||||||
|
rpsL231(strR) |
streptomycin resistant |
||||||
|
rpsL999(strR) |
streptomycin resistant |
||||||
|
rpsL254(strR) |
streptomycin resistant |
||||||
|
rpsL255 |
|||||||
|
rpsL261(strR) |
streptomycin resistant |
||||||
|
rpsL35(strR) |
streptomycin resistant |
||||||
|
rpsL146(strR) |
streptomycin resistant |
||||||
|
rpsL110(strR) |
streptomycin resistant |
||||||
|
rpsL145(strR) |
streptomycin resistant |
||||||
|
rpsL257(strR) |
streptomycin resistant |
||||||
|
rpsL284(strR) |
streptomycin resistant |
||||||
|
rpsL283(strR) |
streptomycin resistant |
||||||
|
rpsL180(strR) |
streptomycin resistant |
||||||
|
rpsL182(strR) |
streptomycin resistant |
||||||
|
rpsL204(strR) |
streptomycin resistant |
||||||
|
[rpsL203](strR) |
streptomycin resistant |
||||||
|
rpsL160(strR) |
streptomycin resistant |
||||||
|
rpsL140(strR) |
streptomycin resistant |
||||||
|
rpsL149(strR) |
streptomycin resistant |
||||||
|
rpsL157(strR) |
streptomycin resistant |
||||||
|
rpsL115(strR) |
streptomycin resistant |
||||||
|
rpsL20(strR) |
streptomycin resistant |
||||||
|
rpsL62(strR) |
streptomycin resistant |
||||||
|
rpsL201(strR) |
streptomycin resistant |
||||||
|
rpsL192(strR) |
streptomycin resistant |
||||||
|
rpsL190(strR) |
streptomycin resistant |
||||||
|
rpsL194(strR) |
streptomycin resistant |
||||||
|
rpsL193(strR) |
streptomycin resistant |
||||||
|
rpsL56(strR) |
streptomycin resistant |
||||||
|
rpsL171(strR) |
streptomycin resistant |
||||||
|
rpsL230(strR) |
streptomycin resistant |
||||||
|
rpsL273(strR) |
streptomycin resistant |
||||||
|
rpsL132(strR) |
streptomycin resistant |
||||||
|
rpsL174(strR) |
streptomycin resistant |
||||||
|
rpsL159(strR) |
streptomycin resistant |
||||||
|
rpsL27(strR) |
streptomycin resistant |
||||||
|
rpsL138(strR) |
streptomycin resistant |
||||||
|
rpsL69(strR) |
streptomycin resistant |
||||||
|
rpsL71(strR) |
streptomycin resistant |
||||||
|
rpsL24(strR) |
streptomycin resistant |
||||||
|
rpsL281(strR) |
streptomycin resistant |
||||||
|
rpsL263(strR) |
streptomycin resistant |
||||||
|
rpsL185(strR) |
streptomycin resistant |
||||||
|
rpsL260(strR) |
streptomycin resistant |
||||||
|
rpsL154(strR) |
streptomycin resistant |
||||||
|
rpsL120(strR) |
streptomycin resistant |
||||||
|
rpsL264(strR) |
streptomycin resistant |
||||||
|
rpsL268(strR) |
streptomycin resistant |
||||||
|
rpsL127(strR) |
streptomycin resistant |
||||||
|
rpsL16(strR) |
streptomycin resistant |
||||||
|
rpsL712(strR) |
streptomycin resistant |
||||||
|
rpsL60(strR) |
streptomycin resistant |
||||||
|
rpsL106(strR) |
streptomycin resistant |
||||||
|
rpsL123(strR) |
streptomycin resistant |
||||||
|
rpsL144(strR) |
streptomycin resistant |
||||||
|
rpsL183(strR) |
streptomycin resistant |
||||||
|
rpsL133(strR) |
streptomycin resistant |
||||||
|
rpsL229(strR) |
streptomycin resistant |
||||||
|
rpsL227(strR) |
streptomycin resistant |
||||||
|
rpsL218(strR) |
streptomycin resistant |
||||||
|
rpsL217(strR) |
streptomycin resistant |
||||||
|
rpsL253(strR) |
streptomycin resistant |
||||||
|
rpsL272(strR) |
streptomycin resistant |
||||||
|
rpsL275(strR) |
streptomycin resistant |
||||||
|
rpsL252(strR) |
streptomycin resistant |
||||||
|
rpsL18(strR) |
streptomycin resistant |
||||||
|
rpsL38(strR) |
streptomycin resistant |
||||||
|
rpsL23(strR) |
streptomycin resistant |
||||||
|
rpsL112(strR) |
streptomycin resistant |
||||||
|
rpsL40 |
|||||||
|
rpsL30(strR) |
streptomycin resistant |
||||||
|
rpsL33(strR) |
streptomycin resistant |
||||||
|
rpsL114(strR) |
streptomycin resistant |
||||||
|
rpsL12(strR) |
streptomycin resistant |
||||||
|
rpsL143(strR) |
streptomycin resistant |
||||||
|
rpsL102(strR) |
streptomycin resistant |
||||||
|
rpsL119(strR) |
streptomycin resistant |
||||||
|
rpsL137(strR) |
streptomycin resistant |
||||||
|
rpsL139(strR) |
streptomycin resistant |
||||||
|
rpsL256(strR) |
streptomycin resistant |
||||||
|
rpsL184(strR) |
streptomycin resistant |
||||||
|
rpsL176(strR) |
streptomycin resistant |
||||||
|
rpsL199(strR) |
streptomycin resistant |
||||||
|
rpsL262(strR) |
streptomycin resistant |
||||||
|
rpsL58(strR) |
streptomycin resistant |
||||||
|
rpsL90(strR) |
streptomycin resistant |
||||||
|
rpsL219(strR) |
streptomycin resistant |
||||||
|
rpsL61(strR) |
streptomycin resistant |
||||||
|
rpsL91(strR) |
streptomycin resistant |
||||||
|
rpsL93(strR) |
streptomycin resistant |
||||||
|
rpsL94(strR) |
streptomycin resistant |
||||||
|
rpsL95(strR) |
streptomycin resistant |
||||||
|
rpsL128(strR) |
streptomycin resistant |
||||||
|
rpsL215(strR) |
streptomycin resistant |
||||||
|
rpsL221(strR) |
streptomycin resistant |
||||||
|
rpsL222(strR) |
streptomycin resistant |
||||||
|
rpsL224(strR) |
streptomycin resistant |
||||||
|
rpsL226(strR) |
streptomycin resistant |
||||||
|
rpsL290(strR) |
streptomycin resistant |
||||||
|
rpsL267(strR) |
streptomycin resistant |
||||||
|
rpsL321 |
|||||||
|
rpsL286 |
|||||||
|
rpsL9 |
|||||||
|
SmR in UK325 |
Streptomycin resistance was introduced to protein S12 (rpsL) |
Sensitivity to |
Altered activity toward Dimethyl Sulfate at position A908 |
Mutation also in strains Uk326, UK327 & UK235. See figure 2a. | |||
|
rpsL4 SmD in EB30 |
Streptomycin dependence was introduced into protein S12. |
Sensitivity to |
Reduced sensitivity toward DMS at positions A908 and A909 |
See figure 2A | |||
|
rpsL4 SmD in EB30 |
Addition of SmD into the S12 gene |
Sensitivity to |
After the addition of SmD there is reduced reactivity toward dimethyl sulfate at position A1413 |
See Figure 2b | |||
|
rpsL4 SmD in EB30 |
Introduction of SmD into protein S12 |
Sensitivity to |
Reduced reactivity toward kethoxal at position G1487 after the introduction of SmD |
See Figure 2C | |||
|
rpsL1rpsD2 |
Insertion of SmI into the rpsL and rpsD alleles |
Sensitivity to |
Insertion of streptomycin independence into both the rpsL and rpsD induced significantly greater reactivity with DMS at position A26. |
See Figure 1 for the Autoradiograph | |||
|
rpsL1, rpsD4 |
Insertion of SmI into the rpsL and rpsD alleles |
Sensitivity to |
Insertion of streptomycin independence into both the rpsL and rpsD induced significantly greater reactivity with DMS at position A8. |
See Figure 1 for the Autoradiograph | |||
|
glnV44 rpsL-asuB3 |
Insertion of anti-suppressor genes. |
Suppressor efficiency |
Decrease in suppressor efficiency |
See table 5 for results of suppressor efficiency test. | |||
|
spcA strA |
Resistant to |
Resistant to Neamine |
Strain:KMBL-146 |
Table 4 results are traceable references here [10] | |||
|
rpsE-nea319 rpsL-nea319 |
Arg to Ser in Peptide T2 [11] Pro to Leu in peptide T15 [11] |
Resistant to |
resistance to neamine |
See Figure 7 for analysis of double mutation | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3304 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAACAGTTAACCAGCTGGT Primer 2:CCAGCCTTAGGACGCTTCACGCC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 15% [15] | ||
|
Linked marker |
est. P1 cotransduction: 30% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Funatsu, G et al. (1977) Primary stucture of protein S12 from the small Escherichia coli ribosomal subunit. FEBS Lett. 73 12-7 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ Chakrabarti, S & Gorini, L (1975) Growth of bacteriophages MS2 and T7 on streptomycin-resistant mutants of Escherichia coli. J. Bacteriol. 121 670-4 PubMed
- ↑ Chakrabarti, SL & Gorini, L (1975) A link between streptomycin and rifampicin mutation. Proc. Natl. Acad. Sci. U.S.A. 72 2084-7 PubMed
- ↑ 6.0 6.1 6.2 6.3 6.4 Allen, PN & Noller, HF (1989) Mutations in ribosomal proteins S4 and S12 influence the higher order structure of 16 S ribosomal RNA. J. Mol. Biol. 208 457-68 PubMed
- ↑ Bar, RS et al. (1989) Insulin-like growth factor-binding proteins from vascular endothelial cells: purification, characterization, and intrinsic biological activities. Endocrinology 125 1910-20 PubMed
- ↑ Sullivan, MA & Bock, RM (1985) Isolation and characterization of antisuppressor mutations in Escherichia coli. J. Bacteriol. 161 377-84 PubMed
- ↑ Bailey, L et al. (1976) An iridovirus from bees. J. Gen. Virol. 31 459-61 PubMed
- ↑ De Wilde, M et al. (1975) Cooperative control of translation fidelity by ribosomal proteins in Escherichia coli. I. Properties of ribosomal mutants whose resistance to neamine is the cumulative effect of two distinct mutations. Mol. Gen. Genet. 142 19-33 PubMed
- ↑ 11.0 11.1 11.2 Yaguchi, M et al. (1975) Cooperative control of translational fidelity by ribosomal proteins in Escherichia coli. II. Localization of amino acid replacements in proteins S5 and S12 altered in double mutants resistant to neamine. Mol. Gen. Genet. 142 35-43 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 CGSC: The Coli Genetics Stock Center
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
