rplK:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
rplK |
|---|---|
| Gene Synonym(s) |
ECK3974, b3983, JW3946, relC[1], relC |
| Product Desc. |
50S ribosomal subunit protein L11[2][3]; Component of 50S ribosomal subunit[3]; ribosome[2][3] 50S ribosomal subunit protein L11; kasugamycin sensitivity[4] |
| Product Synonyms(s) |
50S ribosomal subunit protein L11[1], B3983[2][1], RelC[2][1], RplK[2][1] , ECK3974, JW3946, relC, b3983 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rplKAJL-rpoBC[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rplK |
|---|---|
| Mnemonic |
Ribosomal protein, large |
| Synonyms |
ECK3974, b3983, JW3946, relC[1], relC |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
90.02 minutes, 90.02 minutes |
MG1655: 4176470..4176898 |
||
|
NC_012967: 4158058..4158486 |
||||
|
NC_012759: 4066150..4066578 |
||||
|
W3110 |
|
W3110: 3458234..3457806 |
||
|
DH10B: 4276166..4276594 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4176473 |
Edman degradation |
PMID:7004866 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rplK(del) (Keio:JW3946) |
deletion |
deletion |
PMID:16738554 |
||||
|
rplK3 |
|||||||
|
rplK757(del)::kan |
PMID:16738554 |
||||||
|
Ksgd rplK MV2 |
Antibiotic Dependence |
Kasugamycin Dependence |
PMID:363701 |
See Figure 2A for Gel electropherogram of 70S ribosomal proteins | |||
|
ErmDep rplK |
The ribosomal protein L11 was removed |
Growth Phenotype |
A loss of erythromycin dependent translation |
PMID:387748 |
It is unknown whether or not this caused renewed sensitivity toward Erythromycin only that growth was no longer dependent on it. Mutants include AM68, AM76 and AM77 (table 1.) See figure 1. | ||
| edit table |
<protect></protect>
Notes
The Keio collection[6] lists a deletion of rplK. The insertion in this strain is a duplication of the rplK region.[7]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3946 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCTAAGAAAGTACAAGCCTA Primer 2:CCGTCCTCCACTACCAGGCCCAT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 41% [8] | ||
|
Linked marker |
est. P1 cotransduction: 53% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000863 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0865 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013029 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RplK |
|---|---|
| Synonyms |
50S ribosomal subunit protein L11[1], B3983[2][1], RelC[2][1], RplK[2][1] , ECK3974, JW3946, relC, b3983 |
| Product description |
50S ribosomal subunit protein L11[2][3]; Component of 50S ribosomal subunit[3]; ribosome[2][3] 50S ribosomal subunit protein L11; kasugamycin sensitivity[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000911 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006519 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020783 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020785 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00736 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000911 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006519 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020783 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020785 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019843 |
rRNA binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00736 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019843 |
rRNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0699 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of 50S ribosomal subunit |
could be indirect |
||
|
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rplS |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rplA |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
yfgD |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rplN |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rcsF |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
inaA |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
insC1 |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rplD |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rpsM |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
rpsC |
PMID:16606699 |
Experiment(s):EBI-1147159 | |
|
Protein |
Subunits of ribosome |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MAKKVQAYVK LQVAAGMANP SPPVGPALGQ QGVNIMEFCK AFNAKTDSIE KGLPIPVVIT VYADRSFTFV TKTPPAAVLL KKAAGIKSGS GKPNKDKVGK ISRAQLQEIA QTKAADMTGA DIEAMTRSIE GTARSMGLVV ED |
| Length |
142 |
| Mol. Wt |
14.875 kDa |
| pI |
10.0 (calculated) |
| Extinction coefficient |
2,980 - 3,105 (calc based on 2 Y, 0 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0013029 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000863 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0865 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.02E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
153601 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
21385 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
94611 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4176450..4176490
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rplK | |
|
microarray |
Summary of data for rplK from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to rplK Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0865 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000863 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013029 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
RPLK |
From SHIGELLACYC |
|
E. coli O157 |
RPLK |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10872 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000863 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0865 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013029 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


