{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rplK
Gene Synonym(s)	ECK3974, b3983, JW3946, relC^[1], relC
Product Desc.	50S ribosomal subunit protein L11^[2]^[3]; Component of 50S ribosomal subunit^[3]; ribosome^[2]^[3] 50S ribosomal subunit protein L11; kasugamycin sensitivity^[4]
Product Synonyms(s)	50S ribosomal subunit protein L11^[1], B3983^[2]^[1], RelC^[2]^[1], RplK^[2]^[1] , ECK3974, JW3946, relC, b3983
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rplKAJL-rpoBC^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rplK
Mnemonic	Ribosomal protein, large
Synonyms	ECK3974, b3983, JW3946, relC^[1], relC
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	90.02 minutes, 90.02 minutes	MG1655: 4176470..4176898 <gbrowseImage> name=NC_000913:4176470..4176898 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4158058..4158486 <gbrowseImage> name=NC_012967:4158058..4158486 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4066150..4066578 <gbrowseImage> name=NC_012759:4066150..4066578 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3458234..3457806 <gbrowseImage> name=NC_007779:3457806..3458234 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4276166..4276594 <gbrowseImage> name=NC_010473:4276166..4276594 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4176473	Edman degradation	PMID:7004866
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
rplK(del) (Keio:JW3946)	deletion	deletion			PMID:16738554	Shigen CGSC10845^[5]
rplK3						CGSC:73978
rplK757(del)::kan					PMID:16738554	CGSC:102776
Ksg^d rplK MV2			Antibiotic Dependence	Kasugamycin Dependence	PMID:363701		See Figure 2A for Gel electropherogram of 70S ribosomal proteins
Erm^Dep rplK	The ribosomal protein L11 was removed		Growth Phenotype	A loss of erythromycin dependent translation	PMID:387748		It is unknown whether or not this caused renewed sensitivity toward Erythromycin only that growth was no longer dependent on it. Mutants include AM68, AM76 and AM77 (table 1.) See figure 1.
edit table

Notes

The Keio collection^[6] lists a deletion of rplK. The insertion in this strain is a duplication of the rplK region.^[7]

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3946	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGCTAAGAAAGTACAAGCCTA Primer 2:CCGTCCTCCACTACCAGGCCCAT
E11C11	Kohara Phage	Genobase	PMID:3038334
argE86::Tn10	Linked marker	CAG12185 = CGSC7471^[5]	est. P1 cotransduction: 41% ^[8]
thiC39::Tn10	Linked marker	CAG18500 = CGSC7472^[5]	est. P1 cotransduction: 53% ^[8] Synonyms:thi-39::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10872	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10872	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000863	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948484	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0865	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013029	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RplK
Synonyms	50S ribosomal subunit protein L11^[1], B3983^[2]^[1], RelC^[2]^[1], RplK^[2]^[1] , ECK3974, JW3946, relC, b3983
Product description	50S ribosomal subunit protein L11^[2]^[3]; Component of 50S ribosomal subunit^[3]; ribosome^[2]^[3] 50S ribosomal subunit protein L11; kasugamycin sensitivity^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000911	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006519	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020783	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003735	structural constituent of ribosome	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020785	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00736	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000911	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006519	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020783	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006412	translation	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020785	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019843	rRNA binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00736	F	Seeded from EcoCyc (v14.0)	complete
	GO:0019843	rRNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0699	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of 50S ribosomal subunit	could be indirect
Protein	nadE		PMID:16606699	Experiment(s):EBI-1147159
Protein	rplB		PMID:16606699	Experiment(s):EBI-1147159
Protein	rplS		PMID:16606699	Experiment(s):EBI-1147159
Protein	rplA		PMID:16606699	Experiment(s):EBI-1147159
Protein	yfgD		PMID:16606699	Experiment(s):EBI-1147159
Protein	rplN		PMID:16606699	Experiment(s):EBI-1147159
Protein	dnaK		PMID:16606699	Experiment(s):EBI-1147159
Protein	rcsF		PMID:16606699	Experiment(s):EBI-1147159
Protein	inaA		PMID:16606699	Experiment(s):EBI-1147159
Protein	insC1		PMID:16606699	Experiment(s):EBI-1147159
Protein	rplD		PMID:16606699	Experiment(s):EBI-1147159
Protein	rpsM		PMID:16606699	Experiment(s):EBI-1147159
Protein	rpsC		PMID:16606699	Experiment(s):EBI-1147159
Protein	Subunits of ribosome	could be indirect
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MAKKVQAYVK LQVAAGMANP SPPVGPALGQ QGVNIMEFCK AFNAKTDSIE KGLPIPVVIT VYADRSFTFV TKTPPAAVLL KKAAGIKSGS GKPNKDKVGK ISRAQLQEIA QTKAADMTGA DIEAMTRSIE GTARSMGLVV ED
Length	142
Mol. Wt	14.875 kDa
pI	10.0 (calculated)
Extinction coefficient	2,980 - 3,105 (calc based on 2 Y, 0 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0A7J7
Domain	72..140	PF00298 Ribosomal protein L11, RNA binding domain		PMID:19920124
Domain	8..67	PF03946 Ribosomal protein L11, N-terminal domain		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rplK taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131813	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948484	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013029	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A7J7	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10872	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10872	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948484	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000863	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0865	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	1.02E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	153601	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	21385	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	94611	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rplKAJL-rpoBC
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:4176450..4176490 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3983 (EcoliWiki Page)	NCBI GEO profiles for rplK
microarray	GenExpDB:b3983 (EcoliWiki Page)	Summary of data for rplK from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to rplK Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10872	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0865	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3983
EcoGene	EcoGene:EG10872	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000863	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013029	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000015385 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT1G32990 (score: 1.000; bootstrap: 91%) AT5G51610 (score: 0.292)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000019979 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00035643 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00015133 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000018680 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040718-294 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040718-324 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0201601 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0038234 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA17398-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000329630 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000011644 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000010280 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:2137215 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000006760 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000027091 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YNL185C (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC14867c (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000134424 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00031223001 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000044453 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	RPLK	From SHIGELLACYC
E. coli O157	RPLK	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:46906
Panther (EcoliWiki Page)	PTHR11661:SF1
Superfamily (EcoliWiki Page)	SUPERFAMILY:54747
Pfam (EcoliWiki Page)	PF00298 Ribosomal protein L11, RNA binding domain
Pfam (EcoliWiki Page)	PF03946 Ribosomal protein L11, N-terminal domain
EcoCyc	EcoCyc:EG10872	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10872	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000863	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0865	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013029	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
↑ ^8.0 ^8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

rplK:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rplK Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search