rplK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rplK |
|---|---|
| Mnemonic |
Ribosomal protein, large |
| Synonyms |
ECK3974, b3983, JW3946, relC[1], relC |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
90.02 minutes, 90.02 minutes |
MG1655: 4176470..4176898 |
||
|
NC_012967: 4158058..4158486 |
||||
|
NC_012759: 4066150..4066578 |
||||
|
W3110 |
|
W3110: 3458234..3457806 |
||
|
DH10B: 4276166..4276594 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4176473 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rplK(del) (Keio:JW3946) |
deletion |
deletion |
|||||
|
rplK3 |
|||||||
|
rplK757(del)::kan |
|||||||
|
Ksgd rplK MV2 |
Antibiotic Dependence |
Kasugamycin Dependence |
See Figure 2A for Gel electropherogram of 70S ribosomal proteins | ||||
|
ErmDep rplK |
The ribosomal protein L11 was removed |
Growth Phenotype |
A loss of erythromycin dependent translation |
It is unknown whether or not this caused renewed sensitivity toward Erythromycin only that growth was no longer dependent on it. Mutants include AM68, AM76 and AM77 (table 1.) See figure 1. | |||
| edit table |
Notes
The Keio collection[3] lists a deletion of rplK. The insertion in this strain is a duplication of the rplK region.[7]
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3946 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTAAGAAAGTACAAGCCTA Primer 2:CCGTCCTCCACTACCAGGCCCAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 41% [10] | ||
|
Linked marker |
est. P1 cotransduction: 53% [10] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Dognin, MJ & Wittmann-Liebold, B (1980) Purification and primary structure determination of the N-terminal blocked protein, L11, from Escherichia coli ribosomes. Eur. J. Biochem. 112 131-51 PubMed
- ↑ 3.0 3.1 3.2 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Dabbs, ER (1978) Kasugamycin-dependent mutants of Escherichia coli. J. Bacteriol. 136 994-1001 PubMed
- ↑ Dabbs, ER (1979) Selection for Escherichia coli mutants with proteins missing from the ribosome. J. Bacteriol. 140 734-7 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).