ptsI:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ptsI |
|---|---|
| Mnemonic |
Phosphotransferase system |
| Synonyms |
ECK2411, b2416, JW2409, ctr[1], ctr |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
54.57 minutes |
MG1655: 2532088..2533815 |
||
|
NC_012967: 2462792..2464519 |
||||
|
NC_012759: 2417893..2419620 |
||||
|
W3110 |
|
W3110: 2539512..2541239 |
||
|
DH10B: 2623853..2625580 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2532088 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ptsI(del) (Keio:JW2409) |
deletion |
deletion |
|||||
|
ptsI::Tn5KAN-2 (FB20789) |
Insertion at nt 1687 in Minus orientation |
contains pKD46 | |||||
|
ptsI211 |
|||||||
|
ptsI19(ts) |
temperature sensitive |
||||||
|
ptsI24 |
|||||||
|
ptsI7 |
|||||||
|
ptsI2 |
|||||||
|
ptsI40 |
|||||||
|
ptsI0(del) |
|||||||
|
ptsI34(polar) |
|||||||
|
ptsI6 |
|||||||
|
ptsI27(del) |
|||||||
|
ptsI745(del)::kan |
|||||||
|
ptsI strain D21e18 |
Resistant to |
Ampicillin resistance |
Table 2 | ||||
|
ptsI in strain D21e18 |
Auxotrophies |
Galactose negative |
D21e18 |
table 7. | |||
|
ptsI in strain D21e18 |
Resistant to |
resistant to phage C21 |
D21e18 |
Table 2. | |||
|
ptsI in strain D21e18 |
Utilization of carbon |
Was unable to grown in minimal medium with glucose as sole carbon source. |
D21e18 |
||||
|
ptsH in strain E187 |
Resistant to |
Resistant to phosphonomycin |
Strain:E187 |
Table 1 | |||
|
ptsHI in strain L191 |
Resistant to |
Double mutant is resistant to streptozotocin |
Strain: L191 |
Table 1 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2409 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATTTCAGGCATTTTAGCATC Primer 2:CCGCAGATTGTTTTTTCTTCAAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 44% [11] | ||
|
Linked marker |
est. P1 cotransduction: 4% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 Eriksson-Grennberg, KR et al. (1971) Resistance of Escherichia coli to penicillins. IX. Genetics and physiology of class II ampicillin-resistant mutants that are galactose negative or sensitive to bacteriophage C21, or both. J. Bacteriol. 108 1210-23 PubMed
- ↑ Venkateswaran, PS & Wu, HC (1972) Isolation and characterization of a phosphonomycin-resistant mutant of Escherichia coli K-12. J. Bacteriol. 110 935-44 PubMed
- ↑ Ammer, J et al. (1979) Phosphorylation of streptozotocin during uptake via the phosphoenolpyruvate: sugar phosphotransferase system in Escherichia coli. Antimicrob. Agents Chemother. 16 801-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).