ompR:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompR |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK3392, b3405, JW3368, cry, ompB, kmt[1], kmt |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
76.17 minutes |
MG1655: 3534606..3533887 |
||
|
NC_012967: 3465268..3464549 |
||||
|
NC_012759: 3421044..3421763 |
||||
|
W3110 |
|
W3110: 4103832..4104551 |
||
|
DH10B: 3632351..3631632 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ompR(del) (Keio:JW3368) |
deletion |
deletion |
|||||
|
ompR::Tn5KAN-I-SceI (FB21168) |
Insertion at nt 434 in Plus orientation |
does not contain pKD46 | |||||
|
ompR::Tn5KAN-I-SceI (FB21169) |
Insertion at nt 434 in Plus orientation |
contains pKD46 | |||||
|
ompR(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ompR(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
ompR321(Am, polar) |
polar |
amber (UAG) mutation | |||||
|
ompR739(del)::kan |
|||||||
|
ompR101 |
164-182 |
inframe deletion |
Growth Phenotype |
produces no protein even though ompR mRNA is present |
|||
|
ompR1 |
deletion |
deletion of amino acids 164-182 near the C-terminus |
lost proteins |
lack both OmpF and OmpC proteins |
|||
|
ompR3 |
point mutation at N-terminal |
at amino acid 15 (C43 to T) |
increased protein expression |
OmpC expression is significant even in low-osmolarity medium |
|||
|
ompR4 |
point mutation |
C211 is changed to T at amino acid 71 |
protein expression |
Expression of OmpC was significant even in low-osmolarity medium |
|||
|
ompR20 |
point mutation at the C-terminal |
C448 is changed to T at amino acid 150 |
protein expression |
OmpF expression was significant in high-osmolarity medium |
|||
|
ompR2 |
point mutation at the C-terminal |
G607 was changed to A at amino acid 203 |
protein expression |
OmpF expression was significant in high-osmolarity medium |
|||
|
ompR77 |
point mutation |
Leu-to-Gln at amino acid 16 from the N-terminus of OmpR |
protein expression |
Suppresses envZ11 pleiotropic defects |
|||
|
ompRres |
protein expresison |
ompF expression increases with increasing osmolarity and ompC expression has no apparent change |
|||||
|
ompR(del) |
deletion |
Change in the expression of a gene |
Decrease in the expression of rybB gene. |
See Figure 1 A. | |||
|
ompR in strain 834 |
Resistant to |
chlormaphenicol resistant |
Strain: 834 |
||||
|
ompR in strain 834 |
Resistant to |
copper resistance |
Strain: 834 |
||||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin A |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin E2 |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin E3 |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin K |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin L |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to colicin S4 |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
partially Resistant to colicin X |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to Me1 |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to hy2 |
CS197 |
Table 2 | |||
|
ompR in strain CS197 |
Resistant to |
Resistant to Tulb |
CS197 |
Table 2 | |||
|
ompB1422 |
Resistant to |
Resistance to beta lactam Cefoxitin |
Strains: B1436, B1437 (omp1350), pop1389 (ompB101) |
Table 3. | |||
|
ompB1422 |
Resistant to |
Resistance to Beta Lactam Ampicillin. |
Strains: B1436, B1437 (omp1350), pop1389 (ompB101) |
Table 3. | |||
|
ompR- |
Resistant to |
Small increase in Microcin B17 resistance |
See table 4 for results of level of resistance test. | ||||
|
ompR-'recA - |
Resistant to |
Double mutation caused partial increase in Microcin B17 resistance |
See table 4 for results of resistance experiment. | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3368 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAAGAGAACTACAAGATTCT Primer 2:CCTGCTTTAGAGCCGTCCGGTAC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 30% [18] | ||
|
Linked marker |
est. P1 cotransduction: 32% [18] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 5.0 5.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Garrett, S et al. (1985) Isolation and characterization of delta ompB strains of Escherichia coli by a general method based on gene fusions. J. Bacteriol. 162 840-4 PubMed
- ↑ Coyer, J et al. (1990) micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change. J. Bacteriol. 172 4143-50 PubMed
- ↑ 8.0 8.1 8.2 8.3 8.4 Nara, F et al. (1986) Molecular analysis of mutant ompR genes exhibiting different phenotypes as to osmoregulation of the ompF and ompC genes of Escherichia coli. Mol Gen Genet 202 194-9 PubMed
- ↑ 9.0 9.1 Hall, MN & Silhavy, TJ (1981) Genetic analysis of the ompB locus in Escherichia coli K-12. J. Mol. Biol. 151 1-15 PubMed
- ↑ Matsuyama, S et al. (1986) Interaction between two regulatory proteins in osmoregulatory expression of ompF and ompC genes in Escherichia coli: a novel ompR mutation suppresses pleiotropic defects caused by an envZ mutation. J. Bacteriol. 168 1309-14 PubMed
- ↑ Nara, F et al. (1984) Mutation causing reverse osmoregulation of synthesis of OmpF, a major outer membrane protein of Escherichia coli. J. Bacteriol. 159 688-92 PubMed
- ↑ Thompson, KM et al. (2007) SigmaE regulates and is regulated by a small RNA in Escherichia coli. J. Bacteriol. 189 4243-56 PubMed
- ↑ 13.00 13.01 13.02 13.03 13.04 13.05 13.06 13.07 13.08 13.09 13.10 13.11 Pugsley, AP & Schnaitman, CA (1978) Outer membrane proteins of Escherichia coli. VII. Evidence that bacteriophage-directed protein 2 functions as a pore. J. Bacteriol. 133 1181-9 PubMed
- ↑ 14.0 14.1 Jaffe, A et al. (1982) Role of porin proteins OmpF and OmpC in the permeation of beta-lactams. Antimicrob. Agents Chemother. 22 942-8 PubMed
- ↑ 15.0 15.1 Laviña, M et al. (1986) Identification, mapping, cloning and characterization of a gene (sbmA) required for microcin B17 action on Escherichia coli K12. J. Gen. Microbiol. 132 1685-93 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 17.0 17.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 18.0 18.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
