nuoI:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
nuoI |
---|---|
Gene Synonym(s) |
ECK2275, b2281, JW2276[1], JW2276 |
Product Desc. |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit I, complex I; NADH dehydrogenase I[4] |
Product Synonyms(s) |
NADH:ubiquinone oxidoreductase, chain I[1], B2281[2][1], NuoI[2][1] , ECK2275, JW2276, b2281 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): nuoABCEFGHIJKLMN[2], nuo1-14 |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
nuoI |
---|---|
Mnemonic |
NADH:ubiquinone oxidoreductase |
Synonyms |
ECK2275, b2281, JW2276[1], JW2276 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
51.6 minutes |
MG1655: 2394472..2393930 |
||
NC_012967: 2340041..2339499 |
||||
NC_012759: 2279735..2280277 |
||||
W3110 |
|
W3110: 2401120..2400578 |
||
DH10B: 2486237..2485695 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
2393930 |
Edman degradation |
PMID:9298646 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔnuoI (Keio:JW2276) |
deletion |
deletion |
PMID:16738554 |
||||
nuoI::Tn5KAN-2 (FB20738) |
Insertion at nt 226 in Minus orientation |
PMID:15262929 |
contains pKD46 | ||||
nuoI::Tn5KAN-2 (FB20739) |
Insertion at nt 226 in Minus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-6-phosphate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
|||
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
PMID:16095938 |
|||
ΔnuoI763::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2276 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACCTTAAAAGAATTGTTAGT Primer 2:CCtGGTAACAGGCTCTTGACGTC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 86% [6] | ||
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001994 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB2013 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007539 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
NuoI |
---|---|
Synonyms |
NADH:ubiquinone oxidoreductase, chain I[1], B2281[2][1], NuoI[2][1] , ECK2275, JW2276, b2281 |
Product description |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit I, complex I; NADH dehydrogenase I[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
NOT |
GO:0005737 |
cytoplasm |
PMID:7607227 |
IMP: Inferred from Mutant Phenotype |
C |
Seeded from Riley et al 2006 [1]. See Discussion page for explanation of 'NOT' qualifier. |
complete | |
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The NADH dehydrogenase I complex fractionates with cytoplasmic membranes. |
complete | ||
GO:0005506 |
iron ion binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01351 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
Contributes to |
GO:0003954 |
NADH dehydrogenase activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH. |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
PMID:7690854 |
ISS: Inferred from Sequence or Structural Similarity |
UniProtKB:P29921 |
F |
E. coli NuoI is 31% identical to the NQO9 subunit of NADH dehydrogenase I from Paracoccus denitrificans. EPR spectra from purified, recombinant, reconstituted NQO9 protein is consistent with the presence of two [4Fe-4S] clusters.[7] |
complete | |
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001450 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The E. coli NADH dehydrogenase complex was purified and the subunits separated by SDS-PAGE. The N-termini of these 6 polypeptides were sequenced after deblocking with methanolic HCl. |
complete | ||
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017900 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009051 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016651 |
oxidoreductase activity, acting on NADH or NADPH |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010226 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019684 |
photosynthesis, light reaction |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01351 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019898 |
extrinsic to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9903 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0048038 |
quinone binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0874 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0050136 |
NADH dehydrogenase (quinone) activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.6.99.5 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001450 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009051 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017900 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0411 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010226 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0004 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01351 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009051 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010226 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of connecting fragment of NADH dehydrogenase I |
could be indirect |
||
Protein |
rimJ |
PMID:16606699 |
Experiment(s):EBI-1142422 | |
Protein |
gpmB |
PMID:16606699 |
Experiment(s):EBI-1142422 | |
Protein |
Subunits of NADH dehydrogenase I |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
Cytoplasm |
PMID:9298646, PMID:11416161 |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MTLKELLVGF GTQVRSIWMI GLHAFAKRET RMYPEEPVYL PPRYRGRIVL TRDPDGEERC VACNLCAVAC PVGCISLQKA ETKDGRWYPE FFRINFSRCI FCGLCEEACP TTAIQLTPDF EMGEYKRQDL VYEKEDLLIS GPGKYPEYNF YRMAGMAIDG KDKGEAENEA KPIDVKSLLP |
Length |
180 |
Mol. Wt |
20.537 kDa |
pI |
5.3 (calculated) |
Extinction coefficient |
24,410 - 25,535 (calc based on 9 Y, 2 W, and 9 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0007539 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001994 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2013 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
2352 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
926 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
1943 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2394452..2394492
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for nuoI | |
microarray |
Summary of data for nuoI from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to nuoI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2013 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001994 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007539 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Apis mellifera |
|
From Inparanoid:20070104 |
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Bos taurus |
|
From Inparanoid:20070104 |
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
Canis familiaris |
|
From Inparanoid:20070104 |
Ciona intestinalis |
|
From Inparanoid:20070104 |
Danio rerio |
|
From Inparanoid:20070104 |
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
Drosophila melanogaster |
|
From Inparanoid:20070104 |
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
Homo sapiens |
|
From Inparanoid:20070104 |
Macaca mulatta |
|
From Inparanoid:20070104 |
Monodelphis domestica |
|
From Inparanoid:20070104 |
Mus musculus |
|
From Inparanoid:20070104 |
Pan troglodytes |
|
From Inparanoid:20070104 |
Rattus norvegicus |
|
From Inparanoid:20070104 |
Takifugu rubripes |
|
From Inparanoid:20070104 |
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
NUOI |
From SHIGELLACYC |
E. coli O157 |
NUOI |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12089 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001994 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2013 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0007539 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Yano, T et al. (1999) Characterization of the putative 2x[4Fe-4S]-binding NQO9 subunit of the proton-translocating NADH-quinone oxidoreductase (NDH-1) of Paracoccus denitrificans. Expression, reconstitution, and EPR characterization. J. Biol. Chem. 274 28598-605 PubMed
Categories
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157