nuoI:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nuoI |
|---|---|
| Mnemonic |
NADH:ubiquinone oxidoreductase |
| Synonyms |
ECK2275, b2281, JW2276[1], JW2276 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.6 minutes |
MG1655: 2394472..2393930 |
||
|
NC_012967: 2340041..2339499 |
||||
|
NC_012759: 2279735..2280277 |
||||
|
W3110 |
|
W3110: 2401120..2400578 |
||
|
DH10B: 2486237..2485695 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2393930 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔnuoI (Keio:JW2276) |
deletion |
deletion |
|||||
|
nuoI::Tn5KAN-2 (FB20738) |
Insertion at nt 226 in Minus orientation |
contains pKD46 | |||||
|
nuoI::Tn5KAN-2 (FB20739) |
Insertion at nt 226 in Minus orientation |
does not contain pKD46 | |||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-6-phosphate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
ΔnuoI::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
||||
|
ΔnuoI763::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2276 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCTTAAAAGAATTGTTAGT Primer 2:CCtGGTAACAGGCTCTTGACGTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 86% [10] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [10] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Moreno-Bruna, B et al. (2001) Adenosine diphosphate sugar pyrophosphatase prevents glycogen biosynthesis in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 98 8128-32 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 7.00 7.01 7.02 7.03 7.04 7.05 7.06 7.07 7.08 7.09 7.10 7.11 7.12 7.13 7.14 7.15 7.16 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).