{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	nuoB
Gene Synonym(s)	ECK2281, b2287, JW5875^[1], JW5875
Product Desc.	NuoB^[2]^[3]; Component of connecting fragment of NADH dehydrogenase I^[3]; NADH dehydrogenase I^[2]^[3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I^[4]
Product Synonyms(s)	NADH:ubiquinone oxidoreductase, chain B^[1], B2287^[2]^[1], NuoB^[2]^[1] , ECK2281, JW5875, b2287
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): nuoABCEFGHIJKLMN^[2], nuo1-14
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

NuoB has iron-sulfur cluster N2. HT_Cmplx18_Mem: NuoB+NuoC.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	nuoB
Mnemonic	NADH:ubiquinone oxidoreductase
Synonyms	ECK2281, b2287, JW5875^[1], JW5875
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	51.77 minutes	MG1655: 2402635..2401973 <gbrowseImage> name=NC_000913:2401973..2402635 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2348204..2347542 <gbrowseImage> name=NC_012967:2347542..2348204 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2287778..2288440 <gbrowseImage> name=NC_012759:2287778..2288440 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2409283..2408621 <gbrowseImage> name=NC_007779:2408621..2409283 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2494400..2493738 <gbrowseImage> name=NC_010473:2493738..2494400 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	2401973	Edman degradation	PMID:7607227 PMID:11997136
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔnuoB (Keio:JW5875)	deletion	deletion			PMID:16738554	Shigen
nuoB::Tn5KAN-2 (FB20747)	Insertion at nt 608 in Plus orientation				PMID:15262929	E. coli Genome Project:FB20747	contains pKD46
nuoB::Tn5KAN-2 (FB20748)	Insertion at nt 608 in Plus orientation				PMID:15262929	E. coli Genome Project:FB20748	does not contain pKD46
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire Succinate	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire Bromosuccinate	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire Glucuronamide	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire L-Alanine	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire L-Alanyl-glycine	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire L-Asparagine	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire L-Aspartate	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire Glycyl-L-aspartate	PMID:16095938
ΔnuoB::kan	deletion		Biolog:respiration	unable to respire L-Serine	PMID:16095938
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW5875	Plasmid clone	Shigen	PMID:16769691 Status:cloned as old JW Primer 1:GCCGATTATACGCTCACCCGCAT Primer 2:CCAATCTCGTCAGGTGTACGCAG
9C2	Kohara Phage	Genobase	PMID:3038334
zfb-223::Tn10	Linked marker	CAG18484 = CGSC7406^[5]	est. P1 cotransduction: 65% ^[6] Synonyms:zej-223::Tn10
zfd-1::Tn10	Linked marker	CAG18467 = CGSC7408^[5]	est. P1 cotransduction: % ^[6] Synonyms:zfb-1::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12083	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12083	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001989	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946738	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2008	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007551	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	NuoB
Synonyms	NADH:ubiquinone oxidoreductase, chain B^[1], B2287^[2]^[1], NuoB^[2]^[1] , ECK2281, JW5875, b2287
Product description	NuoB^[2]^[3]; Component of connecting fragment of NADH dehydrogenase I^[3]; NADH dehydrogenase I^[2]^[3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I^[4]
EC number (for enzymes)	1.6.5.3^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
NOT	GO:0005737	cytoplasm	PMID:7607227	IDA: Inferred from Direct Assay		C	Seeded from Riley et al 2006 ^[1]. See discussion page for explanation of the 'NOT' qualifier.	complete
	GO:0030964	NADH dehydrogenase complex	PMID:7607227	IDA: Inferred from Direct Assay		C	The E. coli NADH dehydrogenase complex was purified and the subunits separated by SDS-PAGE. The N-termini of these 6 polypeptides were sequenced after deblocking with methanolic HCl.	complete
	GO:0005506	iron ion binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01356	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	PMID:7607227	IDA: Inferred from Direct Assay		C	The NADH dehydrogenase I complex fractionates with cytoplasmic membranes.	complete
	GO:0005506	iron ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0408	F	Seeded from EcoCyc (v14.0)	complete
Contributes to	GO:0003954	NADH dehydrogenase activity	PMID:3122832	IDA: Inferred from Direct Assay		F	Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH.	complete
	GO:0008137	NADH dehydrogenase (ubiquinone) activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006137	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051539	4 iron, 4 sulfur cluster binding	PMID:12975362	IMP: Inferred from Mutant Phenotype		F	Mutation of cysteine residues in nuoB results in loss of the EPR spectral signal characteristic of the N2 [4Fe-4S] cluster in NADH dehydrogenase I.	complete
	GO:0008137	NADH dehydrogenase (ubiquinone) activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006138	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	PMID:16858726	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0019684	photosynthesis, light reaction	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01356	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0479	F	Seeded from EcoCyc (v14.0)	complete
	GO:0048038	quinone binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006137	F	Seeded from EcoCyc (v14.0)	complete
	GO:0048038	quinone binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006138	F	Seeded from EcoCyc (v14.0)	complete
	GO:0048038	quinone binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0874	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051539	4 iron, 4 sulfur cluster binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006137	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051539	4 iron, 4 sulfur cluster binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006138	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051539	4 iron, 4 sulfur cluster binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014406	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051539	4 iron, 4 sulfur cluster binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0004	F	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01356	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006137	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006138	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014406	P	Seeded from EcoCyc (v14.0)	complete
	GO:0055114	oxidation reduction	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0560	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes
Protein	Subunits of connecting fragment of NADH dehydrogenase I	could be indirect
Protein	Subunits of NADH dehydrogenase I	could be indirect
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
Cytoplasm		PMID:7607227	EchoLocation:nuoB
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MDYTLTRIDP NGENDRYPLQ KQEIVTDPLE QEVNKNVFMG KLNDMVNWGR KNSIWPYNFG LSCCYVEMVT SFTAVHDVAR FGAEVLRASP RQADLMVVAG TCFTKMAPVI QRLYDQMLEP KWVISMGACA NSGGMYDIYS VVQGVDKFIP VDVYIPGCPP RPEAYMQALM LLQESIGKER RPLSWVVGDQ GVYRANMQSE RERKRGERIA VTNLRTPDEI
Length	220
Mol. Wt	25.055 kDa
pI	5.6 (calculated)
Extinction coefficient	36,900 - 37,525 (calc based on 10 Y, 4 W, and 5 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	62..172	PF01058 NADH ubiquinone oxidoreductase, 20 Kd subunit		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=nuoB taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130222	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946738	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007551	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AFC7	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG12083	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12083	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946738	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001989	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2008	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	1.04E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	46.786+/-0.414	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.395015106	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	4225	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	1617	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3708	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
nuoABCEFGHIJKLMN
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:2402615..2402655 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2287 (EcoliWiki Page)	NCBI GEO profiles for nuoB
microarray	GenExpDB:b2287 (EcoliWiki Page)	Summary of data for nuoB from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to nuoB Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12083	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2008	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2287
EcoGene	EcoGene:EG12083	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001989	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007551	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000019428 (score: 1.000; bootstrap: 100%) ENSANGP00000017108 (score: 0.655) ENSANGP00000014787 (score: 0.655)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000012479 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT5G11770 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000025870 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00033393 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00012376 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000028874 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000005374 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0218687 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0030718 (score: 1.000; bootstrap: 100%) FBgn0039669 (score: 0.603)	From Inparanoid:20070104
Drosophila pseudoobscura	GA15185-PA (score: 1.000; bootstrap: 100%) GA21592-PA (score: 0.634)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000015781 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000233627 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000006378 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:1922656 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	Q6I5H0 (score: 1.000; bootstrap: 64%) Q8W0E8 (score: 0.839)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000017334 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000037256 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000157736 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00019327001 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000007999 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	NUOB	From SHIGELLACYC
E. coli O157	NUOB	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01058 NADH ubiquinone oxidoreductase, 20 Kd subunit
Panther (EcoliWiki Page)	PTHR11995:SF2
Superfamily (EcoliWiki Page)	SUPERFAMILY:56770
EcoCyc	EcoCyc:EG12083	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12083	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001989	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2008	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007551	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

nuoB:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to nuoB Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search