nuoB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
nuoB |
|---|---|
| Gene Synonym(s) |
ECK2281, b2287, JW5875[1], JW5875 |
| Product Desc. |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I[4] |
| Product Synonyms(s) |
NADH:ubiquinone oxidoreductase, chain B[1], B2287[2][1], NuoB[2][1] , ECK2281, JW5875, b2287 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): nuoABCEFGHIJKLMN[2], nuo1-14 |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
NuoB has iron-sulfur cluster N2. HT_Cmplx18_Mem: NuoB+NuoC.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nuoB |
|---|---|
| Mnemonic |
NADH:ubiquinone oxidoreductase |
| Synonyms |
ECK2281, b2287, JW5875[1], JW5875 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.77 minutes |
MG1655: 2402635..2401973 |
||
|
NC_012967: 2348204..2347542 |
||||
|
NC_012759: 2287778..2288440 |
||||
|
W3110 |
|
W3110: 2409283..2408621 |
||
|
DH10B: 2494400..2493738 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2401973 |
Edman degradation |
PMID:7607227 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔnuoB (Keio:JW5875) |
deletion |
deletion |
PMID:16738554 |
||||
|
nuoB::Tn5KAN-2 (FB20747) |
Insertion at nt 608 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
nuoB::Tn5KAN-2 (FB20748) |
Insertion at nt 608 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
PMID:16095938 |
|||
|
ΔnuoB::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5875 |
Plasmid clone |
PMID:16769691 Status:cloned as old JW Primer 1:GCCGATTATACGCTCACCCGCAT Primer 2:CCAATCTCGTCAGGTGTACGCAG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 65% [6] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001989 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB2008 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007551 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
NuoB |
|---|---|
| Synonyms |
NADH:ubiquinone oxidoreductase, chain B[1], B2287[2][1], NuoB[2][1] , ECK2281, JW5875, b2287 |
| Product description |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I[4] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
NOT |
GO:0005737 |
cytoplasm |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
Seeded from Riley et al 2006 [1]. See discussion page for explanation of the 'NOT' qualifier. |
complete | |
|
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The E. coli NADH dehydrogenase complex was purified and the subunits separated by SDS-PAGE. The N-termini of these 6 polypeptides were sequenced after deblocking with methanolic HCl. |
complete | ||
|
GO:0005506 |
iron ion binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01356 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The NADH dehydrogenase I complex fractionates with cytoplasmic membranes. |
complete | ||
|
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0003954 |
NADH dehydrogenase activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH. |
complete | |
|
GO:0008137 |
NADH dehydrogenase (ubiquinone) activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
PMID:12975362 |
IMP: Inferred from Mutant Phenotype |
F |
Mutation of cysteine residues in nuoB results in loss of the EPR spectral signal characteristic of the N2 [4Fe-4S] cluster in NADH dehydrogenase I. |
complete | ||
|
GO:0008137 |
NADH dehydrogenase (ubiquinone) activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006138 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
|
GO:0019684 |
photosynthesis, light reaction |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01356 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048038 |
quinone binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048038 |
quinone binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006138 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048038 |
quinone binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0874 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006138 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014406 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0004 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01356 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006138 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014406 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of connecting fragment of NADH dehydrogenase I |
could be indirect |
||
|
Protein |
Subunits of NADH dehydrogenase I |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
PMID:7607227 |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MDYTLTRIDP NGENDRYPLQ KQEIVTDPLE QEVNKNVFMG KLNDMVNWGR KNSIWPYNFG LSCCYVEMVT SFTAVHDVAR FGAEVLRASP RQADLMVVAG TCFTKMAPVI QRLYDQMLEP KWVISMGACA NSGGMYDIYS VVQGVDKFIP VDVYIPGCPP RPEAYMQALM LLQESIGKER RPLSWVVGDQ GVYRANMQSE RERKRGERIA VTNLRTPDEI |
| Length |
220 |
| Mol. Wt |
25.055 kDa |
| pI |
5.6 (calculated) |
| Extinction coefficient |
36,900 - 37,525 (calc based on 10 Y, 4 W, and 5 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0007551 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001989 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2008 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.04E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
Ecoli K-12 |
46.786+/-0.414 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.395015106 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
4225 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
1617 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
3708 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2402615..2402655
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for nuoB | |
|
microarray |
Summary of data for nuoB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to nuoB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2008 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001989 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007551 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
NUOB |
From SHIGELLACYC |
|
E. coli O157 |
NUOB |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12083 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001989 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2008 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007551 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


