{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	mutH
Gene Synonym(s)	ECK2827, b2831, JW2799, mutR, prv^[1], prv
Product Desc.	MutH^[2]^[3]; Component of MutHLS complex, methyl-directed mismatch repair^[2]^[3] Methyl-directed mismatch repair^[4]
Product Synonyms(s)	methyl-directed mismatch repair protein^[1], B2831^[2]^[1], Prv^[2]^[1], MutR^[2]^[1], MutH^[2]^[1] , ECK2827, JW2799, mutR, prv, b2831
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): mutH^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	mutH
Mnemonic	Mutator
Synonyms	ECK2827, b2831, JW2799, mutR, prv^[1], prv
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	63.96 minutes	MG1655: 2967684..2968373 <gbrowseImage> name=NC_000913:2967684..2968373 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2864282..2864971 <gbrowseImage> name=NC_012967:2864282..2864971 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2854832..2855521 <gbrowseImage> name=NC_012759:2854832..2855521 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2968318..2969007 <gbrowseImage> name=NC_007779:2968318..2969007 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3061554..3062243 <gbrowseImage> name=NC_010473:3061554..3062243 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	2967687	Edman degradation	PMID:3031619
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
ΔmutH (Keio:JW2799)	deletion	deletion		PMID:16738554	Shigen CGSC10186^[5]
mutH::Tn5KAN-I-SceI (FB20953)	Insertion at nt 200 in Minus orientation			PMID:15262929	E. coli Genome Project:FB20953	contains pKD46
mutH::Tn5KAN-I-SceI (FB20954)	Insertion at nt 200 in Minus orientation			PMID:15262929	E. coli Genome Project:FB20954	does not contain pKD46
mutHQ135K		Q135K	(in strain: ECOR 51, ECOR 52, ECOR 57, ECOR 59, ECOR 62 and ECOR 64)			Strain variation; seeded from UniProt:P06722
mutHG64R		G64R	(in strain: ECOR 50)			Strain variation; seeded from UniProt:P06722
mutHD157N		D157N	In TS28; temperature-sensitive			seeded from UniProt:P06722
mutHQ153R		Q153R	(in strain: ECOR 67)			Strain variation; seeded from UniProt:P06722
mutHR155C		R155C	(in strain: ECOR 35)			Strain variation; seeded from UniProt:P06722
mutHT28L		T28L	In TS7; temperature-sensitive			seeded from UniProt:P06722
mutHW58S		W58S	(in strain: ECOR 67)			Strain variation; seeded from UniProt:P06722
mutHG60C		G60C	(in strain: ECOR 13, ECOR 20, ECOR 26 and ECOR 70)			Strain variation; seeded from UniProt:P06722
mutH34				PMID:1092652	CGSC:12133
mutH471::kan					CGSC:30821
mutH472::mini-Tn10				PMID:1649454	CGSC:38814
ΔmutH756::kan				PMID:16738554	CGSC:101972
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2799	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTCCCAACCTCGCCCACTGCT Primer 2:CCtTGGATCAGAAAATGACGGGC
5A10	Kohara Phage	Genobase	PMID:3038334
8H3	Kohara Phage	Genobase	PMID:3038334
recD1901::Tn10	Linked marker	CAG12135 = CGSC7429^[5]	est. P1 cotransduction: 55% ^[6]
speA210::Tn10	Linked marker	CAG12168 = CGSC7431^[5]	est. P1 cotransduction: % ^[6] Synonyms:zgd-210::Tn10, zgf-210::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10624	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10624	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000617	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947299	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0619	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009287	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	MutH
Synonyms	methyl-directed mismatch repair protein^[1], B2831^[2]^[1], Prv^[2]^[1], MutR^[2]^[1], MutH^[2]^[1] , ECK2827, JW2799, mutR, prv, b2831
Product description	MutH^[2]^[3]; Component of MutHLS complex, methyl-directed mismatch repair^[2]^[3] Methyl-directed mismatch repair^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0006298	mismatch repair	PMID:6987663^[7]	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0004519	endonuclease activity	PMID:2824465^[8] PMID:1601880^[9]	IDA: Inferred from Direct Assay		F		complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004230	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006298	mismatch repair	PMID:2665076^[10]	IDA: Inferred from Direct Assay		P		complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011335	F	Seeded from EcoCyc (v14.0)	complete
	GO:0032300	mismatch repair complex	PMID:6987663^[7]	IGI: Inferred from Genetic Interaction	UniProtKB:P23367\|UniProtKB:P23909	C	With MutL (P23367) and MutS (P23909).	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR018140	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00759	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004230	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR018140	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0255	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00759	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006298	mismatch repair	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00759	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006304	DNA modification	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004230	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006304	DNA modification	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR018140	P	Seeded from EcoCyc (v14.0)	complete
	GO:0043765	T/G mismatch-specific endonuclease activity	PMID:12606120^[11]	IDA: Inferred from Direct Assay		F	activated by MutS and MutL	complete
	GO:0003677	DNA binding	PMID:12606120^[11]	IDA: Inferred from Direct Assay		F		complete
	GO:0006298	mismatch repair	PMID:12606120^[11]	IDA: Inferred from Direct Assay		P		complete
	GO:0000018		PMID:2555716^[12]	IMP: Inferred from Mutant Phenotype				complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of MutHLS complex, methyl-directed mismatch repair	could be indirect
Protein	rplF		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	rplB		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	uvrY		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	napC		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	rplQ		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	slyD		PMID:16606699^[13]	Experiment(s):EBI-1144107
Protein	rpsJ		PMID:19402753^[14]	LCMS(ID Probability):99.6
Protein	dinJ		PMID:19402753^[14]	LCMS(ID Probability):99.6 MALDI(Z-score):26.209733
Protein	MutL	The C-terminal 218 amino acids were sufficient for the two-hybrid interaction with MutH	PMID:9880500^[15]	2-Hybrid Screening
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSQPRPLLSP PETEEQLLAQ AQQLSGYTLG ELAALVGLVT PENLKRDKGW IGVLLEIWLG ASAGSKPEQD FAALGVELKT IPVDSLGRPL ETTFVCVAPL TGNSGVTWET SHVRHKLKRV LWIPVEGERS IPLAQRRVGS PLLWSPNEEE DRQLREDWEE LMDMIVLGQV ERITARHGEY LQIRPKAANA KALTEAIGAR GERILTLPRG FYLKKNFTSA LLARHFLIQ
Length	229
Mol. Wt	25.527 kDa
pI	7.0 (calculated)
Extinction coefficient	37,470 - 37,595 (calc based on 3 Y, 6 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P06722
Domain	58..157	PF02976 DNA mismatch repair enzyme MutH		PMID:19920124^[16]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=mutH taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

MutH structure^[17]

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
Purified protein	MutH E56A^[11]	No detectable endonuclease activity
Purified protein	MutH D70A^[11]	No detectable endonuclease activity Slightly reduced DNA binding
Purified protein	MutH E77A^[11]	No detectable endonuclease activity Slightly reduced DNA binding
Purified protein	MutH K79E^[11]	No detectable endonuclease activity Slightly reduced DNA binding
Purification protocol	Single-step purification of His6-MutH	PMID:8747662
Purified protein	MutH K116E^[11]	No detectable endonuclease activity Slightly reduced DNA binding
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130735	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947299	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009287	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P06722	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10624	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10624	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947299	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000617	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0619	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	1.131+/-0.029	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.005805515	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	119	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	37	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	61^a	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
mutH
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:2967664..2967704 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2831 (EcoliWiki Page)	NCBI GEO profiles for mutH
microarray	GenExpDB:b2831 (EcoliWiki Page)	Summary of data for mutH from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (2966928..2967700) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ12; Well:E2^[18]
edit table

Notes

Accessions Related to mutH Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10624	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0619	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2831
EcoGene	EcoGene:EG10624	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000617	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009287	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	MUTH	From SHIGELLACYC
E. coli O157	MUTH	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF02976 DNA mismatch repair enzyme MutH
Superfamily (EcoliWiki Page)	SUPERFAMILY:52980
EcoCyc	EcoCyc:EG10624	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10624	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000617	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0619	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0009287	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.0 ^7.1 Glickman, BW & Radman, M (1980) Escherichia coli mutator mutants deficient in methylation-instructed DNA mismatch correction. Proc. Natl. Acad. Sci. U.S.A. 77 1063-7 PubMed
↑ Welsh, KM et al. (1987) Isolation and characterization of the Escherichia coli mutH gene product. J. Biol. Chem. 262 15624-9 PubMed
↑ Au, KG et al. (1992) Initiation of methyl-directed mismatch repair. J. Biol. Chem. 267 12142-8 PubMed
↑ Lahue, RS et al. (1989) DNA mismatch correction in a defined system. Science 245 160-4 PubMed
↑ ^11.0 ^11.1 ^11.2 ^11.3 ^11.4 ^11.5 ^11.6 ^11.7 Junop, MS et al. (2003) In vitro and in vivo studies of MutS, MutL and MutH mutants: correlation of mismatch repair and DNA recombination. DNA Repair (Amst.) 2 387-405 PubMed
↑ Rayssiguier, C et al. (1989) The barrier to recombination between Escherichia coli and Salmonella typhimurium is disrupted in mismatch-repair mutants. Nature 342 396-401 PubMed
↑ ^13.0 ^13.1 ^13.2 ^13.3 ^13.4 ^13.5 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^14.0 ^14.1 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Hall, MC & Matson, SW (1999) The Escherichia coli MutL protein physically interacts with MutH and stimulates the MutH-associated endonuclease activity. J. Biol. Chem. 274 1306-12 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Ban, C & Yang, W (1998) Structural basis for MutH activation in E.coli mismatch repair and relationship of MutH to restriction endonucleases. EMBO J. 17 1526-34 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

mutH:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to mutH Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search