minD:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
minD |
|---|---|
| Gene Synonym(s) |
ECK1163, b1175, JW1164, minB[1], minB |
| Product Desc. |
membrane ATPase of the MinC-MinD-MinE system that regulates septum placement[2][3] Inhibition of FtsZ ring polymerization; membrane ATPase that activates MinC; forms membrane-associated coiled arrays on the cytoplasmic face of the inner membrane, more concentrated at the poles[4] |
| Product Synonyms(s) |
membrane ATPase of the MinC-MinD-MinE system[1], B1175[2][1], MinB[2][1], MinD[2][1] , ECK1163, JW1164, minB, b1175 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
The membrane localization of MinD is mediated by an 8-12 residue C-terminal motif, the membrane targeting sequence (MTS), mutations in this region prevent membrane localization, but not MinC binding. MinD contains switch I and II regions (regions that undergo nucleotide-dependent conformational changes responsible for interactions with their partners) involved in MinC interactions. MinCD oscillates (migrates) between coating one half of the cell's membrane (minE ring to pole) to coating the other half every 40 secs, and this may help to identify the cell center. Overexpression causes filamentous biofilm formation.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
minD |
|---|---|
| Mnemonic |
Minicell |
| Synonyms |
ECK1163, b1175, JW1164, minB[1], minB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
26.38 minutes |
MG1655: 1224584..1223772 |
||
|
NC_012967: 1225522..1224710 |
||||
|
NC_012759: 1112493..1113305 |
||||
|
W3110 |
|
W3110: 1226938..1226126 |
||
|
DH10B: 1264825..1264013 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1223775 |
Edman degradation |
PMID:9298646 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
minD::Tn5KAN-2 (FB20261) |
Insertion at nt 152 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
minDG15S |
G15S |
Less effective then wild-type |
seeded from UniProt:P0AEZ3 | ||||
|
minDKT16QR |
KT16QR |
Loss of activity |
seeded from UniProt:P0AEZ3 | ||||
|
minDK16Q |
K16Q |
Loss of activity |
seeded from UniProt:P0AEZ3 | ||||
|
ftsK1::cat ΔminB |
Growth Phenotype |
minicell chains |
PMID:9829960 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1164 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCACGCATTATTGTTGTTAC Primer 2:CCTCCTCCGAACAAGCGTTTGAG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 64% [6] | ||
|
Linked marker |
est. P1 cotransduction: 70% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000590 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0592 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003938 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
MinD |
|---|---|
| Synonyms |
membrane ATPase of the MinC-MinD-MinE system[1], B1175[2][1], MinB[2][1], MinD[2][1] , ECK1163, JW1164, minB, b1175 |
| Product description |
membrane ATPase of the MinC-MinD-MinE system that regulates septum placement[2][3] Inhibition of FtsZ ring polymerization; membrane ATPase that activates MinC; forms membrane-associated coiled arrays on the cytoplasmic face of the inner membrane, more concentrated at the poles[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000166 |
nucleotide binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000917 |
barrier septum formation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0717 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000918 |
selection of site for barrier septum formation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010223 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005524 |
ATP binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0067 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0131 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009236 |
cobalamin biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002586 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016887 |
ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010223 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019898 |
extrinsic to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9903 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0042242 |
cobyrinic acid a,c-diamide synthase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002586 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051301 |
cell division |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0132 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005524 |
ATP binding |
PMID:1836760 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0016887 |
ATPase activity |
PMID:1836760 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0005886 |
plasma membrane |
PMID:1836760 |
EXP: Inferred from Experiment |
C |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
fur |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
dapB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
MinC |
PMID:8752322 |
2 hybrid screen | |
|
Protein |
MinE |
weak interaction detected |
PMID:8752322 |
2-hybird screen |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MARIIVVTSG KGGVGKTTSS AAIATGLAQK GKKTVVIDFD IGLRNLDLIM GCERRVVYDF VNVIQGDATL NQALIKDKRT ENLYILPASQ TRDKDALTRE GVAKVLDDLK AMDFEFIVCD SPAGIETGAL MALYFADEAI ITTNPEVSSV RDSDRILGIL ASKSRRAENG EEPIKEHLLL TRYNPGRVSR GDMLSMEDVL EILRIKLVGV IPEDQSVLRA SNQGEPVILD INADAGKAYA DTVERLLGEE RPFRFIEEEK KGFLKRLFGG |
| Length |
270 |
| Mol. Wt |
29.614 kDa |
| pI |
5.1 (calculated) |
| Extinction coefficient |
7,450 - 7,700 (calc based on 5 Y, 0 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0003938 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000590 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0592 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
UT481 |
3000 |
molecules/cell |
|
quantitative western |
PMID:1836760 | |
|
Protein |
E. coli K-12 MC4100 |
1.32E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 EMG2 |
300 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: Mll7 |
PMID: 9298646 |
|
Protein |
E. coli K-12 MG1655 |
5358 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
2444 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
3324 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1224564..1224604
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for minD | |
|
microarray |
Summary of data for minD from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to minD Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0592 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000590 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003938 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
MIND |
From SHIGELLACYC |
|
E. coli O157 |
MIND |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000590 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0592 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003938 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


