mdh:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mdh |
|---|---|
| Mnemonic |
Malate DeHydrogenase |
| Synonyms |
ECK3225, b3236, JW3205[1], JW3205 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
72.88 minutes |
MG1655: 3382290..3381352 |
||
|
NC_012967: 3312165..3311227 |
||||
|
NC_012759: 3268500..3269438 |
||||
|
W3110 |
|
W3110: 3384123..3383185 |
||
|
DH10B: 3480035..3479097 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3381352 |
Edman degradation |
PMID:7028159[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mdh(del) (Keio:JW3205) |
deletion |
deletion |
|||||
|
mdh::Tn5KAN-I-SceI (FB21080) |
Insertion at nt 659 in Plus orientation |
contains pKD46 | |||||
|
mdh::Tn5KAN-I-SceI (FB21081) |
Insertion at nt 659 in Plus orientation |
does not contain pKD46 | |||||
|
mdhA291S |
A291S |
(in strain: EC35) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhG294A |
G294A |
(in strain: ECOR 45) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhD297N |
D297N |
(in strain: E830587) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhR153C |
R153C |
Loss of interaction with substrate |
seeded from UniProt:P61889 | ||||
|
mdhA232T |
A232T |
(in strain: ECO R37) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhV249I |
V249I |
(in strain: RT083) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhQ289K |
Q289K |
(in strain: EC35, EC38, EC40, EC44, EC46, EC47 and RT272) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhN290S |
N290S |
(in strain: E2666-74, ECOR 27, ECOR 45, RL012A, RT104 and RT174) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhA209P |
A209P |
(in strain: MB001D) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhD71N |
D71N |
(in strain: EC47, EC49, EC50 and RT272) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhA106S |
A106S |
(in strain: ECOR 27 and RT082) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdhA218R |
A218R |
(in strain: A8190, E2666-74, E830587, E851819, E3406, EC10, EC14, EC32, EC35, EC38, EC40, EC44, EC46, EC47, EC49, EC50, EC52, EC58, E64 and EC70) |
Strain variation; seeded from UniProt:P61889 | ||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
mdh(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
mdh-10 |
|||||||
|
mdh-2 |
|||||||
|
mdh-0 |
|||||||
|
mdh-761(del)::kan |
|||||||
|
mdh761(del)::FRTKanFRT |
deletion |
Mutagenesis Rate |
Decrease in Stress Induced Mutagenesis (SIM). |
Parent Stain: SMR4562 Experimental Stain: SMR12060 |
The mutation conferred a medium decrease in SIM with mutant frequency reduced by roughly 67 to 89 percent of the Wild type. See table S3 for full experimental data. | ||
|
mdh761(del)::FRTKanFRT |
deletion |
Sensitivity to |
SDS-EDTA Sensitivity |
Parent Stain: SMR4562 Experimental Stain: SMR12060 |
The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for summarized data. | ||
|
SMR4562 mdh761(del)::FRTKanFRT yiaG-yfp FRTcatFRT |
deletion |
Sigma S activity |
Decrease in SigmaS activity. |
Parental Strain: SMR10582 Experimental Strain: SMR13058 |
See table S8 for full experimental results. | ||
|
CAG45114 mdh761(del)::FRTKanFRT |
Deletion |
Sigma E activity |
Decrease in sigmaE activity |
Parental Strain: CAG45114 Experimental Strain: SMR15356 |
See table S11 for full experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3205 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGTCGCAGTCCTCGGCGC Primer 2:CCtTTATTAACGAACTCTTCGCC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 53% [15] | ||
|
Linked marker |
est. P1 cotransduction: 26% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Fernley, RT et al. (1981) Malate dehydrogenase: isolation from E. coli and comparison with the eukaryotic mitochondrial and cytoplasmic forms. Biosci. Rep. 1 497-507 PubMed
- ↑ Henzel, WJ et al. (1993) Identifying proteins from two-dimensional gels by molecular mass searching of peptide fragments in protein sequence databases. Proc. Natl. Acad. Sci. U.S.A. 90 5011-5 PubMed
- ↑ Nyström, T et al. (1996) Bacterial defense against aging: role of the Escherichia coli ArcA regulator in gene expression, readjusted energy flux and survival during stasis. EMBO J. 15 3219-28 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ 8.0 8.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 9.0 9.1 9.2 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 11.00 11.01 11.02 11.03 11.04 11.05 11.06 11.07 11.08 11.09 11.10 11.11 11.12 11.13 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 12.0 12.1 12.2 12.3 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
