hupA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
hupA |
|---|---|
| Gene Synonym(s) | |
| Product Desc. |
DNA-binding protein HU-α (HU-2)[2]; Transcriptional dual regulator HU-α (HU-2)[3]; Component of HU Transcriptional dual regulator[3] Histone-like protein HU-alpha, HU-2[4] |
| Product Synonyms(s) |
HU, DNA-binding transcriptional regulator, alpha subunit[1], B4000[2][1], HydL[2][1], HupA[2][1] , ECK3992, JW3964, b4000 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HU concentration in the cell determines the mechanical effect; flexible bends responsible for compaction occur at concentrations <100nM, while increased concentrations result in the formation of a rigid nucleoprotein filament and no significant concentration. Mutant HU alters structure and function of the chromosome. HT_Cmplx32_Mem: CspC+Hns+HupA.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hupA |
|---|---|
| Mnemonic |
HU protein |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
90.49 minutes |
MG1655: 4198304..4198576 |
||
|
NC_012967: 4179893..4180165 |
||||
|
NC_012759: 4087984..4088256 |
||||
|
W3110 |
|
W3110: 3436400..3436128 |
||
|
DH10B: 4298000..4298272 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4198304 |
Edman degradation |
PMID:350619 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔhupA (Keio:JW3964) |
deletion |
deletion |
PMID:16738554 |
||||
|
ΔhupA771::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3964 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAACAAGACTCAACTGATTGA Primer 2:CCtTTAACTGCGTCTTTCAGTGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 88% [6] | ||
|
Linked marker |
est. P1 cotransduction: 16% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000459 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0461 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013077 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
HupA |
|---|---|
| Synonyms |
HU, DNA-binding transcriptional regulator, alpha subunit[1], B4000[2][1], HydL[2][1], HupA[2][1] , ECK3992, JW3964, b4000 |
| Product description |
DNA-binding protein HU-α (HU-2)[2]; Transcriptional dual regulator HU-α (HU-2)[3]; Component of HU Transcriptional dual regulator[3] Histone-like protein HU-alpha, HU-2[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000119 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010992 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020816 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
|
GO:0006974 |
response to DNA damage stimulus |
PMID:11967071 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
|
GO:0003677 |
DNA binding |
PMID:10551881 |
IDA: Inferred from Direct Assay |
F |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of HU Transcriptional dual regulator |
could be indirect |
||
|
Protein |
dnaK |
PMID:15690043 |
Experiment(s):EBI-886936 | |
|
Protein |
malP |
PMID:15690043 |
Experiment(s):EBI-886936, EBI-884958 | |
|
Protein |
malQ |
PMID:15690043 |
Experiment(s):EBI-886936 | |
|
Protein |
rpoA |
PMID:15690043 |
Experiment(s):EBI-886936, EBI-883271 | |
|
Protein |
rluB |
PMID:15690043 |
Experiment(s):EBI-886936, EBI-889536 | |
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
ompL |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
yciH |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
cheA |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
rplO |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
rplD |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
nrdI |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
phnN |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
ycgE |
PMID:16606699 |
Experiment(s):EBI-1147250 | |
|
Protein |
hupB |
PMID:15690043 |
Experiment(s):EBI-893204, EBI-884415 | |
|
Protein |
slyD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplW |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
malQ |
PMID:19402753 |
MALDI(Z-score):23.272153 | |
|
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
gpsA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MNKTQLIDVI AEKAELSKTQ AKAALESTLA AITESLKEGD AVQLVGFGTF KVNHRAERTG RNPQTGKEIK IAAANVPAFV SGKALKDAVK |
| Length |
90 |
| Mol. Wt |
9.534 kDa |
| pI |
10.0 (calculated) |
| Extinction coefficient |
0 (calc based on 0 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0013077 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000459 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0461 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
6.10E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
Ecoli K-12 |
940.878+/-6.187 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.3139+/-0.01489 |
Molecules/cell |
|
by FISH |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
1.935661765 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
86734 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
29042 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
38349 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4198284..4198324
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for hupA | |
|
microarray |
Summary of data for hupA from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (4197574..4197902) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to hupA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0461 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000459 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013077 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
HUPA |
From SHIGELLACYC |
|
E. coli O157 |
HUPA |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000459 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0461 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013077 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


