{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	hupA
Gene Synonym(s)	ECK3992, b4000, JW3964, G119, hydL^[1]^[2]
Product Desc.	DNA-binding protein HU-α (HU-2)^[2]; Transcriptional dual regulator HU-α (HU-2)^[3]; Component of HU Transcriptional dual regulator^[3] Histone-like protein HU-alpha, HU-2^[4]
Product Synonyms(s)	HU, DNA-binding transcriptional regulator, alpha subunit^[1], B4000^[2]^[1], HydL^[2]^[1], HupA^[2]^[1] , ECK3992, JW3964, b4000
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): hupA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

HU concentration in the cell determines the mechanical effect; flexible bends responsible for compaction occur at concentrations <100nM, while increased concentrations result in the formation of a rigid nucleoprotein filament and no significant concentration. Mutant HU alters structure and function of the chromosome. HT_Cmplx32_Mem: CspC+Hns+HupA.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	hupA
Mnemonic	HU protein
Synonyms	ECK3992, b4000, JW3964, G119, hydL^[1]^[2]
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	90.49 minutes	MG1655: 4198304..4198576 <gbrowseImage> name=NC_000913:4198304..4198576 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4179893..4180165 <gbrowseImage> name=NC_012967:4179893..4180165 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4087984..4088256 <gbrowseImage> name=NC_012759:4087984..4088256 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3436400..3436128 <gbrowseImage> name=NC_007779:3436128..3436400 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4298000..4298272 <gbrowseImage> name=NC_010473:4298000..4298272 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4198304	Edman degradation	PMID:350619 PMID:6987059 PMID:9298646
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability
ΔhupA (Keio:JW3964)	deletion	deletion	PMID:16738554	Shigen CGSC10851^[5]
ΔhupA771::kan			PMID:16738554	CGSC:101440
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3964	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAACAAGACTCAACTGATTGA Primer 2:CCtTTAACTGCGTCTTTCAGTGC
7B7	Kohara Phage	Genobase	PMID:3038334
thiC39::Tn10	Linked marker	CAG18500 = CGSC7472^[5]	est. P1 cotransduction: 88% ^[6] Synonyms:thi-39::Tn10
malF3089::Tn10	Linked marker	CAG12164 = CGSC7476^[5]	est. P1 cotransduction: 16% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10466	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10466	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000459	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948499	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0461	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013077	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	HupA
Synonyms	HU, DNA-binding transcriptional regulator, alpha subunit^[1], B4000^[2]^[1], HydL^[2]^[1], HupA^[2]^[1] , ECK3992, JW3964, b4000
Product description	DNA-binding protein HU-α (HU-2)^[2]; Transcriptional dual regulator HU-α (HU-2)^[3]; Component of HU Transcriptional dual regulator^[3] Histone-like protein HU-alpha, HU-2^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000119	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR010992	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020816	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	PMID:16858726^[7]	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	PMID:11967071^[8]	IEP: Inferred from Expression Pattern		P		complete
	GO:0003677	DNA binding	PMID:10551881^[9]	IDA: Inferred from Direct Assay		F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of HU Transcriptional dual regulator	could be indirect
Protein	dnaK		PMID:15690043^[10]	Experiment(s):EBI-886936
Protein	malP		PMID:15690043^[10]	Experiment(s):EBI-886936, EBI-884958
Protein	malQ		PMID:15690043^[10]	Experiment(s):EBI-886936
Protein	rpoA		PMID:15690043^[10]	Experiment(s):EBI-886936, EBI-883271
Protein	rluB		PMID:15690043^[10]	Experiment(s):EBI-886936, EBI-889536
Protein	rpsD		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	dnaK		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	ompL		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	yciH		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	rplB		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	cheA		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	rplO		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	rplD		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	nrdI		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	phnN		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	ycgE		PMID:16606699^[11]	Experiment(s):EBI-1147250
Protein	hupB		PMID:15690043^[10]	Experiment(s):EBI-893204, EBI-884415
Protein	slyD		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rplW		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	malQ		PMID:19402753^[12]	MALDI(Z-score):23.272153
Protein	rplM		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	gpsA		PMID:19402753^[12]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MNKTQLIDVI AEKAELSKTQ AKAALESTLA AITESLKEGD AVQLVGFGTF KVNHRAERTG RNPQTGKEIK IAAANVPAFV SGKALKDAVK
Length	90
Mol. Wt	9.534 kDa
pI	10.0 (calculated)
Extinction coefficient	0 (calc based on 0 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	1..90	PF00216 Bacterial DNA-binding protein		PMID:19920124^[13]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=hupA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131830	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948499	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013077	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0ACF0	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10466	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10466	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948499	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000459	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0461	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	6.10E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	940.878+/-6.187	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.3139+/-0.01489	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	1.935661765	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	86734	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	29042	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	38349	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
hupA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:4198284..4198324 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b4000 (EcoliWiki Page)	NCBI GEO profiles for hupA
microarray	GenExpDB:b4000 (EcoliWiki Page)	Summary of data for hupA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (4197574..4197902) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ10; Well:C9^[14]
edit table

Notes

Accessions Related to hupA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10466	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0461	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b4000
EcoGene	EcoGene:EG10466	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000459	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013077	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	HUPA	From SHIGELLACYC
E. coli O157	HUPA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00216 Bacterial DNA-binding protein
Superfamily (EcoliWiki Page)	SUPERFAMILY:47729
EcoCyc	EcoCyc:EG10466	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10466	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000459	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0461	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013077	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Lasserre, JP et al. (2006) A complexomic study of Escherichia coli using two-dimensional blue native/SDS polyacrylamide gel electrophoresis. Electrophoresis 27 3306-21 PubMed
↑ Khil, PP & Camerini-Otero, RD (2002) Over 1000 genes are involved in the DNA damage response of Escherichia coli. Mol. Microbiol. 44 89-105 PubMed
↑ Azam, TA & Ishihama, A (1999) Twelve species of the nucleoid-associated protein from Escherichia coli. Sequence recognition specificity and DNA binding affinity. J. Biol. Chem. 274 33105-13 PubMed
↑ ^10.0 ^10.1 ^10.2 ^10.3 ^10.4 ^10.5 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^11.00 ^11.01 ^11.02 ^11.03 ^11.04 ^11.05 ^11.06 ^11.07 ^11.08 ^11.09 ^11.10 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^12.0 ^12.1 ^12.2 ^12.3 ^12.4 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

hupA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to hupA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search