hfq:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hfq |
|---|---|
| Mnemonic |
Host factor for Q beta |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
94.8 minutes |
MG1655: 4398311..4398619 |
||
|
NC_012967: 4378443..4378751 |
||||
|
NC_012759: 4337046..4337354 |
||||
|
W3110 |
|
W3110: 4404968..4405276 |
||
|
DH10B: 4498673..4498981 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4398314 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
hfq(del) (Keio:JW4130) |
deletion |
deletion |
|||||
|
hfq-722(del)::kan |
|||||||
|
hfq2::omega |
Insertion of omega cassette near the end of hfq sequence |
Growth Phenotype |
hfq maintained limited if not full activity |
the resulting phenotypes showed no substantial difference from hfq+ parent | |||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
Cell Shape |
Elongated Cells(Fig 3). |
||||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
Growth Phenotype |
Decreased growth and yield (table 2). |
||||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
Cell Shape |
Relaxed coiling (Fig. 4) |
||||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
Sensitivity to |
Increased sensitivity to Ultraviolet (u.v.) light |
||||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
Growth Phenotype |
spontaneous mutagenesis |
||||
|
hfq1 |
Growth Phenotype |
stabilizes ompA mRNA |
disruption of hfq1 results in an increase of ompA mRNA half-life but does not affect the level of degradosomal components | ||||
|
hfq1::omega |
Insertion of omega cassette near the start of hfq sequence |
oxidation |
Increased oxidation of various carbon sources (Fig. 5). |
||||
|
Hfq-Q8A |
Glutamine to Alanine at postion 8 |
suppression |
Hfq binding protein regulates mRNA translation by binding to OxyS to repress rpoS mRNA translation. Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to rpoS compared to wildtype Hfq, table 1. |
||||
|
Hfq-R16A |
Argenine to Alanine at position 16. |
suppression |
Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to DsrA compared to wildtype Hfq. Thus translation cannot continue, table 1. |
||||
|
Hfq-F39A |
Phenylalanine to alanine at position 39 |
suppression |
Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to DsrA compared to wildtype Hfq. Thus translation cannot continue, table 1. |
||||
|
hfq1::omega |
A disruption in the middle of the hfq gene |
Change in gene expression |
strongly reduced sigma levels during entry into stationary phase |
Error in labeling see Figure 2 | |||
|
hfq1::omega |
A disruption in the middle of the hfq gene |
A change in gene expression |
the translation of rpoS::lacZ is disrupted in the mutant strain. |
See Figure 3 | |||
|
hfq1::omega |
A disruption in the middle of the hfq gene |
A change in gene expression |
Despite any increase in osmotic upshift there is no increase in cellular sigma content. |
Error in labeling see Figure 1 | |||
|
hfq::omega |
A disruption in the middle of the hfq gene |
A change in gene expression |
osmotic induction of the translational rpoS742::lacZ fusion is impaired. |
See figure 4 | |||
|
F42A |
Phenylalanine to alanine at position 42 |
suppression |
Mutation causes a decrease in biding affinity to rpsO, table 1. |
||||
|
hfq::omega |
A disruption in the middle of hfq gene |
A change in gene expression |
Residual amounts of sigma in exhibit normal regulation |
See Figure 6 | |||
|
hfq(del) |
Null mutation |
Change in the expression of a gene |
Overexpression of rybB in both the exponential and stationary growth phase. |
See Figure 5 C. | |||
|
hfq772(del)::FRT |
Deletion |
Mutagenesis Rate |
Decrease in stress induced mutagenesis (SIM). |
The mutation conferred a strong decrease in SIM, the mutant frequency was reduced by over 90 % of the wild type levels. See table S3 for full experimental data. | |||
|
hfq772(del)::FRT |
Deletion |
Sensitivity to |
Increase UV sensitivity |
The mutation conferred an increase in sensitivity toward UV. See tables S7 and S1 for summarized results. | |||
|
hfq772(del)::FRT |
Deletion |
Sensitivity to |
Increase sensitivity toward SDS-EDTA |
The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for summarized results. | |||
|
SMR4562 yiaG-yfp FRTcatFRT hfq722(del)::FRTKanFRT |
Deletion |
SigmaS activity |
Decrease in Sigma S activity |
Parental Strain: SMR10582 Experimental Strain: SMR14295 |
See table S8 for full experimental results. | ||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4130 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTAAGGGGCAATCTTTACA Primer 2:CCTTCGGTTTCTTCGCTGTCCTG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 17% [17] | ||
|
Linked marker |
est. P1 cotransduction: 34% [17] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Carmichael, GG et al. (1975) The host factor required for RNA phage Qbeta RNA replication in vitro. Intracellular location, quantitation, and purification by polyadenylate-cellulose chromatography. J. Biol. Chem. 250 3607-612 PubMed
- ↑ Kajitani, M & Ishihama, A (1991) Identification and sequence determination of the host factor gene for bacteriophage Q beta. Nucleic Acids Res. 19 1063-6 PubMed
- ↑ Green, J et al. (1996) The ndh-binding protein (Nbp) regulates the ndh gene of Escherichia coli in response to growth phase and is identical to Fis. Mol. Microbiol. 20 1043-55 PubMed
- ↑ Takada, A et al. (1997) DNA binding properties of the hfq gene product of Escherichia coli. Biochem. Biophys. Res. Commun. 236 576-9 PubMed
- ↑ 7.0 7.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 8.0 8.1 8.2 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 9.2 9.3 9.4 9.5 9.6 Tsui, HC et al. (1994) Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K-12. Mol. Microbiol. 13 35-49 PubMed
- ↑ Vytvytska, O et al. (1998) Host factor I, Hfq, binds to Escherichia coli ompA mRNA in a growth rate-dependent fashion and regulates its stability. Proc. Natl. Acad. Sci. U.S.A. 95 14118-23 PubMed
- ↑ 11.0 11.1 11.2 11.3 Updegrove, TB & Wartell, RM (2011) The influence of Escherichia coli Hfq mutations on RNA binding and sRNA•mRNA duplex formation in rpoS riboregulation. Biochim. Biophys. Acta 1809 532-40 PubMed
- ↑ 12.0 12.1 12.2 12.3 12.4 Muffler, A et al. (1996) The RNA-binding protein HF-I, known as a host factor for phage Qbeta RNA replication, is essential for rpoS translation in Escherichia coli. Genes Dev. 10 1143-51 PubMed
- ↑ Thompson, KM et al. (2007) SigmaE regulates and is regulated by a small RNA in Escherichia coli. J. Bacteriol. 189 4243-56 PubMed
- ↑ 14.0 14.1 14.2 14.3 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 17.0 17.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).