{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	hfq
Gene Synonym(s)	ECK4168, b4172, JW4130, HF-I, HF-1^[1]^[2]
Product Desc.	RNA-binding protein that affects many cellular processes; homolog of mammalian Sm/Sm-like proteins^[2]^[3]; Component of HF-I, host factor for RNA phage Q β replication^[3] Global regulator of sRNA function; host factor for RNA phage Q beta replication; HF-I; DNA- and RNA-binding protein; RNA chaperone; multiple regulatory roles: destabilzes ompA mRNA, improves rpoS translation, sRNA DsrA co-factor; binds RNAP; ATPase^[4]
Product Synonyms(s)	HF-I, host factor for RNA phage Q beta replication^[1], B4172^[2]^[1], Hfq^[2]^[1], HF-I^[2]^[1], host factor I^[2]^[1] , ECK4168, JW4130, b4172
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): yjeFE-amiB-mutL-miaA-hfq-hflXKC^[2], ORF55-ORF17-amiB-mutL-miaA-hfq-hflXKC
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

The C-terminal of Hfq is not necessary for hexamerization. RNA binding is located primarily at the N-terminal. Hfq has intrinsic ATPase activity (Sukhodolets, 2003; Arluison, 2007).^[4]

Hfq enhances RNA-RNA pairing. ^[5]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	hfq
Mnemonic	Host factor for Q beta
Synonyms	ECK4168, b4172, JW4130, HF-I, HF-1^[1]^[2]
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	94.8 minutes	MG1655: 4398311..4398619 <gbrowseImage> name=NC_000913:4398311..4398619 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4378443..4378751 <gbrowseImage> name=NC_012967:4378443..4378751 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4337046..4337354 <gbrowseImage> name=NC_012759:4337046..4337354 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4404968..4405276 <gbrowseImage> name=NC_007779:4404968..4405276 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4498673..4498981 <gbrowseImage> name=NC_010473:4498673..4498981 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4398314	Edman degradation	PMID:805130 PMID:2020545 PMID:8809757 PMID:9245691
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
hfq(del) (Keio:JW4130)	deletion	deletion			PMID:16738554	Shigen CGSC10973^[6]
hfq-722(del)::kan					PMID:16738554	CGSC:101354
hfq2::omega	Insertion of omega cassette near the end of hfq sequence		Growth Phenotype	hfq maintained limited if not full activity	PMID:7984093		the resulting phenotypes showed no substantial difference from hfq+ parent
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		Cell Shape	Elongated Cells(Fig 3).	PMID:7984093
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		Growth Phenotype	Decreased growth and yield (table 2).	PMID:7984093
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		Cell Shape	Relaxed coiling (Fig. 4)	PMID:7984093
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		Sensitivity to	Increased sensitivity to Ultraviolet (u.v.) light	PMID:7984093
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		Growth Phenotype	spontaneous mutagenesis	PMID:7984093
hfq1			Growth Phenotype	stabilizes ompA mRNA	PMID:9826663		disruption of hfq1 results in an increase of ompA mRNA half-life but does not affect the level of degradosomal components
hfq1::omega	Insertion of omega cassette near the start of hfq sequence		oxidation	Increased oxidation of various carbon sources (Fig. 5).	PMID:7984093
Hfq-Q8A		Glutamine to Alanine at postion 8	suppression	Hfq binding protein regulates mRNA translation by binding to OxyS to repress rpoS mRNA translation. Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to rpoS compared to wildtype Hfq, table 1.	PMID:21889623
Hfq-R16A		Argenine to Alanine at position 16.	suppression	Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to DsrA compared to wildtype Hfq. Thus translation cannot continue, table 1.	PMID:21889623
Hfq-F39A		Phenylalanine to alanine at position 39	suppression	Proximal surface mutation exhibit a 2.3 to 3.2-fold decrease in affinity to DsrA compared to wildtype Hfq. Thus translation cannot continue, table 1.	PMID:21889623
hfq1::omega	A disruption in the middle of the hfq gene		Change in gene expression	strongly reduced sigma levels during entry into stationary phase	PMID:8654929		Error in labeling see Figure 2
hfq1::omega	A disruption in the middle of the hfq gene		A change in gene expression	the translation of rpoS::lacZ is disrupted in the mutant strain.	PMID:8654929		See Figure 3
hfq1::omega	A disruption in the middle of the hfq gene		A change in gene expression	Despite any increase in osmotic upshift there is no increase in cellular sigma content.	PMID:8654929		Error in labeling see Figure 1
hfq::omega	A disruption in the middle of the hfq gene		A change in gene expression	osmotic induction of the translational rpoS742::lacZ fusion is impaired.	PMID:8654929		See figure 4
F42A		Phenylalanine to alanine at position 42	suppression	Mutation causes a decrease in biding affinity to rpsO, table 1.	PMID:21889623
hfq::omega	A disruption in the middle of hfq gene		A change in gene expression	Residual amounts of sigma in exhibit normal regulation	PMID:8654929		See Figure 6
hfq(del)	Null mutation		Change in the expression of a gene	Overexpression of rybB in both the exponential and stationary growth phase.	PMID:17416652		See Figure 5 C.
hfq772(del)::FRT	Deletion		Mutagenesis Rate	Decrease in stress induced mutagenesis (SIM).	PMID:23224554		The mutation conferred a strong decrease in SIM, the mutant frequency was reduced by over 90 % of the wild type levels. See table S3 for full experimental data.
hfq772(del)::FRT	Deletion		Sensitivity to	Increase UV sensitivity	PMID:23224554		The mutation conferred an increase in sensitivity toward UV. See tables S7 and S1 for summarized results.
hfq772(del)::FRT	Deletion		Sensitivity to	Increase sensitivity toward SDS-EDTA	PMID:23224554		The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for summarized results.
SMR4562 yiaG-yfp FRTcatFRT hfq722(del)::FRTKanFRT	Deletion		Sigma^S activity	Decrease in Sigma ^S activity	PMID:23224554	Parental Strain: SMR10582 Experimental Strain: SMR14295	See table S8 for full experimental results.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW4130	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGCTAAGGGGCAATCTTTACA Primer 2:CCTTCGGTTTCTTCGCTGTCCTG
3A1	Kohara Phage	Genobase	PMID:3038334
cadB2231::Tn10	Linked marker	CAG18488 = CGSC7479^[6]	est. P1 cotransduction: 17% ^[7] Synonyms:zjd-2231::Tn10
cycA30::Tn10	Linked marker	CAG12073 = CGSC7482^[6]	est. P1 cotransduction: 34% ^[7]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10438	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10438	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000431	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948689	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0433	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013659	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	Hfq
Synonyms	HF-I, host factor for RNA phage Q beta replication^[1], B4172^[2]^[1], Hfq^[2]^[1], HF-I^[2]^[1], host factor I^[2]^[1] , ECK4168, JW4130, b4172
Product description	RNA-binding protein that affects many cellular processes; homolog of mammalian Sm/Sm-like proteins^[2]^[3]; Component of HF-I, host factor for RNA phage Q β replication^[3] Global regulator of sRNA function; host factor for RNA phage Q beta replication; HF-I; DNA- and RNA-binding protein; RNA chaperone; multiple regulatory roles: destabilzes ompA mRNA, improves rpoS translation, sRNA DsrA co-factor; binds RNAP; ATPase^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00436	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005001	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0694	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005001	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006950	response to stress	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0346	P	Seeded from EcoCyc (v14.0)	complete
	GO:0040033	negative regulation of translation, ncRNA-mediated	PMID:19118351^[8]	IEP: Inferred from Expression Pattern		P		complete
	GO:0003681	bent DNA binding	PMID:10551881^[9]	IDA: Inferred from Direct Assay		F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of HF-I, host factor for RNA phage Q β replication	could be indirect
Protein	aidB		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rng		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	deaD		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	dnaJ		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	dnaK		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	eno		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	skp		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	hrpA		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	hupA		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	lon		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	lpxD		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	pnp		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rho		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	rne		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-893488
Protein	rplA		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rplB		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rplC		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	rplD		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	rpoA		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rpoB		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rpoC		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rpsA		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	rpsB		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	rpsC		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rpsD		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rpsM		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	secA		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	selB		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	spoT		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	tgt		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	tig		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	tufA		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rnr		PMID:15690043^[10]	Experiment(s):EBI-880595, EBI-886556
Protein	ycbY		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	rluB		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	yfiF		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	ygiF		PMID:15690043^[10]	Experiment(s):EBI-880595
Protein	cspC		PMID:15690043^[10]	Experiment(s):EBI-886556, EBI-883980
Protein	csrA		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	hupB		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	nfi		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplI		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplL		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplM		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplO		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplS		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplT		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplU		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplV		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplX		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpmB		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpsE		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpsF		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpsG		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpsP		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rpsR		PMID:15690043^[10]	Experiment(s):EBI-886556
Protein	rplN		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	ygbA		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	uspG		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	rpsD		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	rplB		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	rob		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	yciH		PMID:16606699^[11]	Experiment(s):EBI-1147620
Protein	tig		PMID:19402753^[12]	MALDI(Z-score):31.467557
Protein	secA		PMID:19402753^[12]	MALDI(Z-score):18.689223
Protein	eno		PMID:19402753^[12]	MALDI(Z-score):25.940163
Protein	tufB		PMID:19402753^[12]	MALDI(Z-score):19.802224
Protein	rpsP		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):6.030298
Protein	rplT		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	dnaJ		PMID:19402753^[12]	MALDI(Z-score):34.289130
Protein	hupB		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rpmB		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rplO		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rplS		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	hupA		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):10.835608
Protein	rpsA		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):26.483554
Protein	rpsF		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rpsR		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rplI		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):7.741650
Protein	lon		PMID:19402753^[12]	MALDI(Z-score):19.371612
Protein	rpsM		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):13.880177
Protein	rplU		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rho		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):39.920671
Protein	rplX		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):5.243101
Protein	rplM		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rplB		PMID:19402753^[12]	LCMS(ID Probability):97.0 MALDI(Z-score):19.110485
Protein	rpsD		PMID:19402753^[12]	LCMS(ID Probability):88.3 MALDI(Z-score):38.038080
Protein	rng		PMID:19402753^[12]	MALDI(Z-score):21.170257
Protein	rplA		PMID:19402753^[12]	LCMS(ID Probability):86.0 MALDI(Z-score):31.573966
Protein	nfi		PMID:19402753^[12]	LCMS(ID Probability):99.6
Protein	rpsC		PMID:19402753^[12]	MALDI(Z-score):33.016691
Protein	skp		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):30.407482
Protein	rpoA		PMID:19402753^[12]	LCMS(ID Probability):86.4 MALDI(Z-score):32.797009
Protein	ygiF		PMID:19402753^[12]	LCMS(ID Probability):85.9 MALDI(Z-score):34.947118
Protein	rlmL		PMID:19402753^[12]	MALDI(Z-score):28.362205
Protein	lpxD		PMID:19402753^[12]	MALDI(Z-score):21.449871
Protein	rnr		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):28.407921
Protein	yfiF		PMID:19402753^[12]	MALDI(Z-score):32.328504
Protein	rplD		PMID:19402753^[12]	LCMS(ID Probability):99.6 MALDI(Z-score):18.730532
Protein	pnp		PMID:19402753^[12]	MALDI(Z-score):28.049574
Protein	hrpA		PMID:19402753^[12]	MALDI(Z-score):18.932128
Protein	csrA		PMID:19402753^[12]	LCMS(ID Probability):99.3
Protein	tgt		PMID:19402753^[12]	MALDI(Z-score):27.516532
Protein	deaD		PMID:19402753^[12]	MALDI(Z-score):27.100042
Protein	selB		PMID:19402753^[12]	MALDI(Z-score):23.285153
Protein	rplL		PMID:19402753^[12]	LCMS(ID Probability):99.6
RNA	ompA mRNA	cells lacking Hfq lose growth rate-dependent regulation; knockout of the hfq gene results in a longer half-life of the ompA mRNA	PMID:9826663^[13]
RNA	rpoS	HF-1 is necessary for establishing normal rates of translation of rpoS	PMID:8654929^[14]	used pulse-chase experiments and analyzed rpoS::lacZ fusions
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
cytoplasm			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MAKGQSLQDP FLNALRRERV PVSIYLVNGI KLQGQIESFD QFVILLKNTV SQMVYKHAIS TVVPSRPVSH HSNNAGGGTS SNYHHGSSAQ NTSAQQDSEE TE
Length	102
Mol. Wt	11.165 kDa
pI	7.8 (calculated)
Extinction coefficient	4,470 (calc based on 3 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0A6X3
Domain	10..64	PF01423 LSM domain		PMID:19920124^[15]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=hfq taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131994	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948689	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013659	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A6X3	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10438	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10438	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948689	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000431	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0433	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	5.85E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	1513.053+/-6.963	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.72468+/-0.01652	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	1.813311688	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	27919	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	8277	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	18677	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
yjeFE-amiB-mutL-miaA-hfq-hflXKC
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:4398291..4398331 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b4172 (EcoliWiki Page)	NCBI GEO profiles for hfq
microarray	GenExpDB:b4172 (EcoliWiki Page)	Summary of data for hfq from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (4397696..4397888) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ02; Well:E12^[16]
edit table

Notes

Accessions Related to hfq Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10438	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0433	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b4172
EcoGene	EcoGene:EG10438	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000431	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013659	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	HFQ	From SHIGELLACYC
E. coli O157	HFQ	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01423 LSM domain
Superfamily (EcoliWiki Page)	SUPERFAMILY:50182
EcoCyc	EcoCyc:EG10438	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10438	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000431	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0433	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013659	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Zhang, A et al. (2002) The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs. Mol. Cell 9 11-22 PubMed
↑ ^6.0 ^6.1 ^6.2 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Pulvermacher, SC et al. (2009) Role of the sRNA GcvB in regulation of cycA in Escherichia coli. Microbiology (Reading, Engl.) 155 106-14 PubMed
↑ Azam, TA & Ishihama, A (1999) Twelve species of the nucleoid-associated protein from Escherichia coli. Sequence recognition specificity and DNA binding affinity. J. Biol. Chem. 274 33105-13 PubMed
↑ ^10.00 ^10.01 ^10.02 ^10.03 ^10.04 ^10.05 ^10.06 ^10.07 ^10.08 ^10.09 ^10.10 ^10.11 ^10.12 ^10.13 ^10.14 ^10.15 ^10.16 ^10.17 ^10.18 ^10.19 ^10.20 ^10.21 ^10.22 ^10.23 ^10.24 ^10.25 ^10.26 ^10.27 ^10.28 ^10.29 ^10.30 ^10.31 ^10.32 ^10.33 ^10.34 ^10.35 ^10.36 ^10.37 ^10.38 ^10.39 ^10.40 ^10.41 ^10.42 ^10.43 ^10.44 ^10.45 ^10.46 ^10.47 ^10.48 ^10.49 ^10.50 ^10.51 ^10.52 ^10.53 ^10.54 ^10.55 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^11.0 ^11.1 ^11.2 ^11.3 ^11.4 ^11.5 ^11.6 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^12.00 ^12.01 ^12.02 ^12.03 ^12.04 ^12.05 ^12.06 ^12.07 ^12.08 ^12.09 ^12.10 ^12.11 ^12.12 ^12.13 ^12.14 ^12.15 ^12.16 ^12.17 ^12.18 ^12.19 ^12.20 ^12.21 ^12.22 ^12.23 ^12.24 ^12.25 ^12.26 ^12.27 ^12.28 ^12.29 ^12.30 ^12.31 ^12.32 ^12.33 ^12.34 ^12.35 ^12.36 ^12.37 ^12.38 ^12.39 ^12.40 ^12.41 ^12.42 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Vytvytska, O et al. (1998) Host factor I, Hfq, binds to Escherichia coli ompA mRNA in a growth rate-dependent fashion and regulates its stability. Proc. Natl. Acad. Sci. U.S.A. 95 14118-23 PubMed
↑ Muffler, A et al. (1996) The RNA-binding protein HF-I, known as a host factor for phage Qbeta RNA replication, is essential for rpoS translation in Escherichia coli. Genes Dev. 10 1143-51 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

hfq:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to hfq Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search