flhD:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
flhD |
---|---|
Gene Synonym(s) |
ECK1893, b1892, JW1881, flbB[1], flbB |
Product Desc. |
Component of FlhDC transcriptional dual regulator[3] Transcriptional activator of flagellar class II operons; forms heterotetramer with FlhC; possible role in regulation of cell division; can function in vivo independently of FlhC, but does not bind DNA by itself; contains HTH motif[4] |
Product Synonyms(s) |
DNA-binding transcriptional dual regulator with FlhC[1], B1892[2][1], FlbB[2][1], FlhD[2][1] , ECK1893, flbB, JW1881, b1892 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
CsrA regulon.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
flhD |
---|---|
Mnemonic |
Flagella |
Synonyms |
ECK1893, b1892, JW1881, flbB[1], flbB |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
42.59 minutes |
MG1655: 1976230..1975871 |
||
NC_012967: 1956976..1956617 |
||||
NC_012759: 1867930..1868281 |
||||
W3110 |
|
W3110: 1979920..1979561 |
||
DH10B: 2066815..2066456 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
flhD(del) (Keio:JW1881) |
deletion |
deletion |
PMID:16738554 |
||||
flhD::Tn5KAN-2 (FB20500) |
Insertion at nt 83 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
flhD::Tn5KAN-2 (FB20501) |
Insertion at nt 83 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
flhD5301 |
PMID:113385 |
||||||
flhD530 |
|||||||
Strain BW2952 |
TTA237-239TATA |
frameshift |
Insertion of a single nucleotide at position 237 results in a frameshift. |
PMID:19376874 |
This is a strain-specific difference in BW2952 relative to E. coli K-12 MG1655. | ||
flhD(del) |
Figure 2 |
deletion |
Growth Phenotype |
Mutation causes it to be more fit than the wild type for intestinal colonization, because los of FlhD causes elevated expression of genes involved in carbon and energy metabolism, resulting in enhanced metabolic efficiency, which is pivital for success in host colonization, figure 1. |
PMID:21422176 |
||
flhD(del) |
500 BP deletion immediately downstream of ISI in regulatory region of flhD, extending into flhD. Table 1. |
deletion |
Cell Shape |
Mutations were non-motile after growth in LB and failed to spread on agar, figure 7. |
PMID:16299298 |
| |
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1881 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGGAATAATGCATACCTCCGA Primer 2:CCGGCCCTTTTCTTGCGCAGCGC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 13% [6] | ||
Linked marker |
est. P1 cotransduction: 60% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000314 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0316 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006303 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FlhD |
---|---|
Synonyms |
DNA-binding transcriptional dual regulator with FlhC[1], B1892[2][1], FlbB[2][1], FlhD[2][1] , ECK1893, flbB, JW1881, b1892 |
Product description |
Component of FlhDC transcriptional dual regulator[3] Transcriptional activator of flagellar class II operons; forms heterotetramer with FlhC; possible role in regulation of cell division; can function in vivo independently of FlhC, but does not bind DNA by itself; contains HTH motif[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007911 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00725 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00725 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009296 |
flagellum assembly |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007911 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016563 |
transcription activator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007911 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045893 |
positive regulation of transcription, DNA-dependent |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00725 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045941 |
positive regulation of transcription |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007911 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of FlhDC transcriptional dual regulator |
could be indirect |
||
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1141229 | |
Protein |
phnN |
PMID:16606699 |
Experiment(s):EBI-1141229 | |
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1141229 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MGIMHTSELL KHIYDINLSY LLLAQRLIVQ DKASAMFRLG INEEMATTLA ALTLPQMVKL AETNQLVCHF RFDSHQTITQ LTQDSRVDDL QQIHTGIMLS TRLLNDVNQP EEALRKKRA |
Length |
119 |
Mol. Wt |
13.617 kDa |
pI |
7.0 (calculated) |
Extinction coefficient |
2,980 - 3,105 (calc based on 2 Y, 0 W, and 1 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0006303 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000314 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0316 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
8.244+/-0.051 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.125348189 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
317 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
122 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
126a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1976210..1976250
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for flhD | |
microarray |
Summary of data for flhD from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
flhDC'-'lacZ |
reporter |
PMID: 12123461 |
| |
edit table |
<protect></protect>
Notes
Accessions Related to flhD Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0316 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000314 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006303 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
E. coli O157 |
FLHD |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10320 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000314 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0316 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006303 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories