eda:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
eda |
|---|---|
| Mnemonic |
Entner-Douderoff aldolase |
| Synonyms |
ECK1851, b1850, JW1839, hga, kdgA, kga[1], kga |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
41.6 minutes |
MG1655: 1930780..1930139 |
||
|
NC_012967: 1911332..1910691 |
||||
|
NC_012759: 1822198..1822839 |
||||
|
W3110 |
|
W3110: 1934470..1933829 |
||
|
DH10B: 2021351..2020710 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1930139 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
eda(del) (Keio:JW1839) |
deletion |
deletion |
|||||
|
eda::Tn5KAN-2 (FB20471) |
Insertion at nt 308 in Plus orientation |
contains pKD46 | |||||
|
eda-51::Tn10 |
Insertion at 1,930,416 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[6] |
Synonyms: | ||||
|
eda-51::Tn10 |
|||||||
|
eda-1 |
|||||||
|
eda-50 |
|||||||
|
eda-10 |
|||||||
|
eda-3126::Tn10kan |
|||||||
|
eda-775(del)::kan |
|||||||
|
eda::miniTn10::npt Strr |
in vivo |
Mutants were unable to colonize mouse intestine to any great extent when fed alone to mice, Fig 3. However, when eda mutants were complemented with a wild-type eda gene, their colonizing ability was restored, fig 5. |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1839 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAACTGGAAAACAAGTGC Primer 2:CCaAGCTTAGCGCCTTCTACAGC | |
|
Linked marker |
est. P1 cotransduction: 4% [6] | ||
|
Linked marker |
est. P1 cotransduction: 4% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Vlahos, CJ & Dekker, EE (1988) The complete amino acid sequence and identification of the active-site arginine peptide of Escherichia coli 2-keto-4-hydroxyglutarate aldolase. J. Biol. Chem. 263 11683-91 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Fraenkel, DG & Banerjee, S (1972) Deletion mapping of zwf, the gene for a constitutive enzyme, glucose 6-phosphate dehydrogenase in Escherichia coli. Genetics 71 481-9 PubMed
- ↑ Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed
- ↑ Sweeney, NJ et al. (1996) Escherichia coli F-18 and E. coli K-12 eda mutants do not colonize the streptomycin-treated mouse large intestine. Infect. Immun. 64 3504-11 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
