uvrC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
uvrC |
|---|---|
| Mnemonic |
UV resistant |
| Synonyms |
ECK1912, b1913, JW1898[1], JW1898 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
42.91 minutes |
MG1655: 1992730..1990898 |
||
|
NC_012967: 1972633..1970867 |
||||
|
NC_012759: 1883381..1885213 |
||||
|
W3110 |
|
W3110: 1996843..1995011 |
||
|
DH10B: 2083738..2081906 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1990901 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
uvrC(del) (Keio:JW1898) |
deletion |
deletion |
|||||
|
uvrC::Tn5KAN-2 (FB20521) |
Insertion at nt 569 in Minus orientation |
contains pKD46 | |||||
|
uvrCR42A |
R42A |
Defective in 3' incision but not in 5' incision |
seeded from UniProt:P0A8G0 | ||||
|
uvrCD399A,N |
D399A,N |
Defective in 5' incision but not in 3' incision |
seeded from UniProt:P0A8G0 | ||||
|
uvrCD438A,N |
D438A,N |
Defective in 5' incision but not in 3' incision |
seeded from UniProt:P0A8G0 | ||||
|
uvrCD466A,N |
D466A,N |
Defective in 5' incision but not in 3' incision |
seeded from UniProt:P0A8G0 | ||||
|
uvrCH538F,Y |
H538F,Y |
Defective in 5' incision but not in 3' incision |
seeded from UniProt:P0A8G0 | ||||
|
uvrC279::Tn10 |
Insertion at 1,991,245 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[6] |
Synonyms: | ||||
|
uvrC34 |
|||||||
|
uvrC279::Tn10 |
|||||||
|
uvrC33 |
|||||||
|
uvrC152 |
|||||||
|
uvrC759(del)::kan |
|||||||
|
uvrC(del)::Tn10 |
deletion |
deletion |
Sensitivity to |
Deletion mutants are more sensitive to DNA damaging agent Mitomycin C, figure 1 & 2. |
Experimental strain: RJF574 |
||
|
uvrA::Tn10 uvrC34 |
Sensitivity to |
Double mutation increased sensitivity to mitomycin C but at a slower rate than single deletions, figure 1. |
|||||
|
uvrC(del) |
deletion |
deletion |
Sensitivity to |
Deletion mutation causes hypersensitive to UV when irradiated and incubated in non-photoreactivating conditions, figure 2. |
|||
|
uvrA::Tn10 uvrC34 |
DNA repair |
Double mutation was able to recover high molecular weight DNA, though at a much slower rate than wild type. |
Figure 4. | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1898 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTGATCAGTTTGACGCAAA Primer 2:CCATGTTTCAACGACCAGAAGAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 4% [6] | ||
|
Linked marker |
est. P1 cotransduction: 13% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Tang Ms, et al. (2001) Two forms of UvrC protein with different double-stranded DNA binding affinities. J. Biol. Chem. 276 3904-10 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 Vidal, LS et al. (2006) Enhanced sensitivity of Escherichia coli uvrB mutants to mitomycin C points to a UV-C distinct repair for DNA adducts. Chem. Res. Toxicol. 19 1351-6 PubMed
- ↑ Crowley, DJ et al. (2006) The uvrA, uvrB and uvrC genes are required for repair of ultraviolet light induced DNA photoproducts in Halobacterium sp. NRC-1. Saline Syst. 2 11 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
