flhD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
flhD |
|---|---|
| Mnemonic |
Flagella |
| Synonyms |
ECK1893, b1892, JW1881, flbB[1], flbB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
42.59 minutes |
MG1655: 1976230..1975871 |
||
|
NC_012967: 1956976..1956617 |
||||
|
NC_012759: 1867930..1868281 |
||||
|
W3110 |
|
W3110: 1979920..1979561 |
||
|
DH10B: 2066815..2066456 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
flhD(del) (Keio:JW1881) |
deletion |
deletion |
|||||
|
flhD::Tn5KAN-2 (FB20500) |
Insertion at nt 83 in Plus orientation |
contains pKD46 | |||||
|
flhD::Tn5KAN-2 (FB20501) |
Insertion at nt 83 in Plus orientation |
does not contain pKD46 | |||||
|
flhD5301 |
|||||||
|
flhD530 |
|||||||
|
Strain BW2952 |
TTA237-239TATA |
frameshift |
Insertion of a single nucleotide at position 237 results in a frameshift. |
This is a strain-specific difference in BW2952 relative to E. coli K-12 MG1655. | |||
|
flhD(del) |
Figure 2 |
deletion |
Growth Phenotype |
Mutation causes it to be more fit than the wild type for intestinal colonization, because los of FlhD causes elevated expression of genes involved in carbon and energy metabolism, resulting in enhanced metabolic efficiency, which is pivital for success in host colonization, figure 1. |
|||
|
flhD(del) |
500 BP deletion immediately downstream of ISI in regulatory region of flhD, extending into flhD. Table 1. |
deletion |
Cell Shape |
Mutations were non-motile after growth in LB and failed to spread on agar, figure 7. |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1881 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGAATAATGCATACCTCCGA Primer 2:CCGGCCCTTTTCTTGCGCAGCGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 13% [11] | ||
|
Linked marker |
est. P1 cotransduction: 60% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Komeda, Y & Iino, T (1979) Regulation of expression of the flagellin gene (hag) in Escherichia coli K-12: analysis of hag-lac gene fusions. J. Bacteriol. 139 721-9 PubMed
- ↑ Ferenci, T et al. (2009) Genomic sequencing reveals regulatory mutations and recombinational events in the widely used MC4100 lineage of Escherichia coli K-12. J. Bacteriol. 191 4025-9 PubMed
- ↑ Fabich, AJ et al. (2011) Genotype and phenotypes of an intestine-adapted Escherichia coli K-12 mutant selected by animal passage for superior colonization. Infect. Immun. 79 2430-9 PubMed
- ↑ Leatham, MP et al. (2005) Mouse intestine selects nonmotile flhDC mutants of Escherichia coli MG1655 with increased colonizing ability and better utilization of carbon sources. Infect. Immun. 73 8039-49 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
