{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	fadR
Gene Synonym(s)	ECK1175, b1187, JW1176, dec, ole, thdB, oleR^[1], oleR
Product Desc.	FadR transcriptional dual regulator^[2]^[3] Repressor/activator for fatty acid metabolism regulon; fatty acid-responsive transcription factor; fabAB, iclR activator (regulates aceBAK, glyoxylate shunt); fad repressor; homodimeric^[4]
Product Synonyms(s)	DNA-binding transcriptional dual regulator of fatty acid metabolism^[1], B1187^[2]^[1], Ole^[2]^[1], Dec^[2]^[1], ThdB^[2]^[1], OleR^[2]^[1], FadR^[2]^[1], negative regulator for fad regulon, and positive activator of fabA^[2]^[1] , dec, ECK1175, JW1176, ole, oleR, thdB, b1187
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): fadR^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

The fad genes are induced and fabAB, iclR are repressed by long chain acyl-CoA thioesters binding to and releasing FadR from the DNA. FadR is a GntR-type DNA-binding transcriptional regulator.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	fadR
Mnemonic	Fatty acid degradation
Synonyms	ECK1175, b1187, JW1176, dec, ole, thdB, oleR^[1], oleR
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	26.6 minutes	MG1655: 1234161..1234880 <gbrowseImage> name=NC_000913:1234161..1234880 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1235088..1235807 <gbrowseImage> name=NC_012967:1235088..1235807 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1122882..1123601 <gbrowseImage> name=NC_012759:1122882..1123601 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1236515..1237234 <gbrowseImage> name=NC_007779:1236515..1237234 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1274402..1275121 <gbrowseImage> name=NC_010473:1274402..1275121 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	1234164	Edman degradation	PMID:1569108
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
fadR(del) (Keio:JW1176)	deletion	deletion			PMID:16738554	Shigen CGSC9082^[5]
fadR::Tn5KAN-2 (FB20265)	Insertion at nt 521 in Plus orientation				PMID:15262929	E. coli Genome Project:FB20265	does not contain pKD46
fadR(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketobutyrate	PMID:16095938
fadR(del)::kan	deletion		Biolog:respiration	unable to respire Bromosuccinate	PMID:16095938
fadR(del)::kan	deletion		Biolog:respiration	unable to respire L-Aspartate	PMID:16095938
fadR13::Tn10	Insertion at 1,234,734 bp in MG1655 (NC_000913)				adapted from Nichols et al.^[6]	CAG18497 = CGSC7365^[5]	Synonyms:
fadR200						CGSC:7029
fadR201						CGSC:7034
fadR613::Tn10					PMID:2540407	CGSC:7231
fadR16						CGSC:7256
fadR202						CGSC:7481
fadR601						CGSC:7503
fadR41(ts)				temperature sensitive		CGSC:23037
fadR3115::Tn10kan					PMID:2540407	CGSC:39427
fadR776(del)::kan					PMID:16738554	CGSC:100788
fadR &thdA1 in MW5	Mutation in the fadR & thdA genes		Resistant to	Resistance to thiophene and furan derivatives	PMID:2285321	CGSC:7034	It was found that the fadR mutation was required in conjunction with the thdA mutation for thiophene and furan derivative resistance. See table 3 for full oxidation experiment results.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW1176	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGTCATTAAGGCGCAAAGCCC Primer 2:CCTCGCCCCTGAATGGCTAAATC
2A3	Kohara Phage	Genobase	PMID:3038334
11G8	Kohara Phage	Genobase	PMID:3038334
zcf-117::Tn10	Linked marker	CAG18463 = CGSC7363^[5]	est. P1 cotransduction: 42% ^[6]
oppC506::Tn10	Linked marker	CAG12169 = CGSC7369^[5]	est. P1 cotransduction: 2% ^[6] Synonyms:zch-506::Tn10, zci-506::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10281	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10281	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000275	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948652	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0277	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003988	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	FadR
Synonyms	DNA-binding transcriptional dual regulator of fatty acid metabolism^[1], B1187^[2]^[1], Ole^[2]^[1], Dec^[2]^[1], ThdB^[2]^[1], OleR^[2]^[1], FadR^[2]^[1], negative regulator for fad regulon, and positive activator of fabA^[2]^[1] , dec, ECK1175, JW1176, ole, oleR, thdB, b1187
Product description	FadR transcriptional dual regulator^[2]^[3] Repressor/activator for fatty acid metabolism regulon; fatty acid-responsive transcription factor; fabAB, iclR activator (regulates aceBAK, glyoxylate shunt); fad repressor; homodimeric^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000062	acyl-CoA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008920	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000062	acyl-CoA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014178	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008920	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014178	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00696	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000524	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008920	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014178	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003700	transcription factor activity	PMID:11279025	ISS: Inferred from Sequence or Structural Similarity	PDB:1CGP PDB:1QPI	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005622	intracellular	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000524	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00696	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006350	transcription	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0804	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000524	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006629	lipid metabolic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0443	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006631	fatty acid metabolic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0276	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016563	transcription activator activity	PMID:11279025	ISS: Inferred from Sequence or Structural Similarity	PDB:1CGP PDB:1QPI	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016564	transcription repressor activity	PMID:11279025	ISS: Inferred from Sequence or Structural Similarity	PDB:1CGP PDB:1QPI	F	Seeded from EcoCyc (v14.0)	complete
	GO:0019217	regulation of fatty acid metabolic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00696	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019217	regulation of fatty acid metabolic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008920	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019217	regulation of fatty acid metabolic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR014178	P	Seeded from EcoCyc (v14.0)	complete
	GO:0032582	negative regulation of gene-specific transcription	PMID:11279025	ISS: Inferred from Sequence or Structural Similarity	PDB:1CGP PDB:1QPI	P	Seeded from EcoCyc (v14.0)	complete
	GO:0043193	positive regulation of gene-specific transcription	PMID:11279025	ISS: Inferred from Sequence or Structural Similarity	PDB:1CGP PDB:1QPI	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045449	regulation of transcription	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00696	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045449	regulation of transcription	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0805	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MVIKAQSPAG FAEEYIIESI WNNRFPPGTI LPAERELSEL IGVTRTTLRE VLQRLARDGW LTIQHGKPTK VNNFWETSGL NILETLARLD HESVPQLIDN LLSVRTNIST IFIRTAFRQH PDKAQEVLAT ANEVADHADA FAELDYNIFR GLAFASGNPI YGLILNGMKG LYTRIGRHYF ANPEARSLAL GFYHKLSALC SEGAHDQVYE TVRRYGHESG EIWHRMQKNL PGDLAIQGR
Length	239
Mol. Wt	26.969 kDa
pI	7.0 (calculated)
Extinction coefficient	33,920 - 34,045 (calc based on 8 Y, 4 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0A8V6
Domain	8..71	PF00392 Bacterial regulatory proteins, gntR family		PMID:19920124
Domain	72..235	PF07840 FadR C-terminal domain		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=fadR taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129150	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948652	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003988	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A8V6	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10281	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10281	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948652	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000275	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0277	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	2.95E+02	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	28.758+/-0.252	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.041724618	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	1840	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	395	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	917	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
fadR
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1234141..1234181 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1187 (EcoliWiki Page)	NCBI GEO profiles for fadR
microarray	GenExpDB:b1187 (EcoliWiki Page)	Summary of data for fadR from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to fadR Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10281	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0277	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1187
EcoGene	EcoGene:EG10281	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000275	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003988	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	FADR	From SHIGELLACYC
E. coli O157	FADR	From ECOO157CYC
edit table

Notes

Families

[back to top]

<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF07840 FadR C-terminal domain
Pfam (EcoliWiki Page)	PF00392 Bacterial regulatory proteins, gntR family
edit table

</protect> <protect></protect>

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 ^1.15 ^1.16 ^1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 ^5.3 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 ^6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

fadR:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to fadR Expression

Notes

Links

Evolution

Homologs in Other Organisms

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search