fadR:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
fadR |
---|---|
Gene Synonym(s) |
ECK1175, b1187, JW1176, dec, ole, thdB, oleR[1], oleR |
Product Desc. |
FadR transcriptional dual regulator[2][3] Repressor/activator for fatty acid metabolism regulon; fatty acid-responsive transcription factor; fabAB, iclR activator (regulates aceBAK, glyoxylate shunt); fad repressor; homodimeric[4] |
Product Synonyms(s) |
DNA-binding transcriptional dual regulator of fatty acid metabolism[1], B1187[2][1], Ole[2][1], Dec[2][1], ThdB[2][1], OleR[2][1], FadR[2][1], negative regulator for fad regulon, and positive activator of fabA[2][1] , dec, ECK1175, JW1176, ole, oleR, thdB, b1187 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
The fad genes are induced and fabAB, iclR are repressed by long chain acyl-CoA thioesters binding to and releasing FadR from the DNA. FadR is a GntR-type DNA-binding transcriptional regulator.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
fadR |
---|---|
Mnemonic |
Fatty acid degradation |
Synonyms |
ECK1175, b1187, JW1176, dec, ole, thdB, oleR[1], oleR |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
26.6 minutes |
MG1655: 1234161..1234880 |
||
NC_012967: 1235088..1235807 |
||||
NC_012759: 1122882..1123601 |
||||
W3110 |
|
W3110: 1236515..1237234 |
||
DH10B: 1274402..1275121 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1234164 |
Edman degradation |
PMID:1569108 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
fadR(del) (Keio:JW1176) |
deletion |
deletion |
PMID:16738554 |
||||
fadR::Tn5KAN-2 (FB20265) |
Insertion at nt 521 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
fadR(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
fadR(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
fadR(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
fadR13::Tn10 |
Insertion at 1,234,734 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[6] |
Synonyms: | ||||
fadR200 |
|||||||
fadR201 |
|||||||
fadR613::Tn10 |
PMID:2540407 |
||||||
fadR16 |
|||||||
fadR202 |
|||||||
fadR601 |
|||||||
fadR41(ts) |
temperature sensitive |
||||||
fadR3115::Tn10kan |
PMID:2540407 |
||||||
fadR776(del)::kan |
PMID:16738554 |
||||||
fadR &thdA1 in MW5 |
Mutation in the fadR & thdA genes |
Resistant to |
Resistance to thiophene and furan derivatives |
PMID:2285321 |
It was found that the fadR mutation was required in conjunction with the thdA mutation for thiophene and furan derivative resistance. See table 3 for full oxidation experiment results. | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1176 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGTCATTAAGGCGCAAAGCCC Primer 2:CCTCGCCCCTGAATGGCTAAATC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 42% [6] | ||
Linked marker |
est. P1 cotransduction: 2% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000275 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0277 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003988 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FadR |
---|---|
Synonyms |
DNA-binding transcriptional dual regulator of fatty acid metabolism[1], B1187[2][1], Ole[2][1], Dec[2][1], ThdB[2][1], OleR[2][1], FadR[2][1], negative regulator for fad regulon, and positive activator of fabA[2][1] , dec, ECK1175, JW1176, ole, oleR, thdB, b1187 |
Product description |
FadR transcriptional dual regulator[2][3] Repressor/activator for fatty acid metabolism regulon; fatty acid-responsive transcription factor; fabAB, iclR activator (regulates aceBAK, glyoxylate shunt); fad repressor; homodimeric[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000062 |
acyl-CoA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008920 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000062 |
acyl-CoA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014178 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008920 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014178 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00696 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000524 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008920 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014178 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
PMID:11279025 |
ISS: Inferred from Sequence or Structural Similarity |
PDB:1CGP |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000524 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00696 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000524 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006629 |
lipid metabolic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0443 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006631 |
fatty acid metabolic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0276 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016563 |
transcription activator activity |
PMID:11279025 |
ISS: Inferred from Sequence or Structural Similarity |
PDB:1CGP |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016564 |
transcription repressor activity |
PMID:11279025 |
ISS: Inferred from Sequence or Structural Similarity |
PDB:1CGP |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019217 |
regulation of fatty acid metabolic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00696 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019217 |
regulation of fatty acid metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008920 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019217 |
regulation of fatty acid metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014178 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0032582 |
negative regulation of gene-specific transcription |
PMID:11279025 |
ISS: Inferred from Sequence or Structural Similarity |
PDB:1CGP |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043193 |
positive regulation of gene-specific transcription |
PMID:11279025 |
ISS: Inferred from Sequence or Structural Similarity |
PDB:1CGP |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045449 |
regulation of transcription |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00696 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045449 |
regulation of transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0805 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MVIKAQSPAG FAEEYIIESI WNNRFPPGTI LPAERELSEL IGVTRTTLRE VLQRLARDGW LTIQHGKPTK VNNFWETSGL NILETLARLD HESVPQLIDN LLSVRTNIST IFIRTAFRQH PDKAQEVLAT ANEVADHADA FAELDYNIFR GLAFASGNPI YGLILNGMKG LYTRIGRHYF ANPEARSLAL GFYHKLSALC SEGAHDQVYE TVRRYGHESG EIWHRMQKNL PGDLAIQGR |
Length |
239 |
Mol. Wt |
26.969 kDa |
pI |
7.0 (calculated) |
Extinction coefficient |
33,920 - 34,045 (calc based on 8 Y, 4 W, and 1 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0003988 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000275 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0277 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
2.95E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
28.758+/-0.252 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.041724618 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
1840 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
395 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
917 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1234141..1234181
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for fadR | |
microarray |
Summary of data for fadR from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to fadR Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0277 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10281 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000275 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003988 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
FADR |
From SHIGELLACYC |
E. coli O157 |
FADR |
From ECOO157CYC |
edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Database | Accession | Notes |
---|---|---|
| ||
edit table |
</protect> <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 5.3 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories