{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	atpE
Gene Synonym(s)	ECK3730, b3737, JW3715, papH, uncE^[1], uncE
Product Desc.	ATP synthase, F0 complex, c subunit^[2]^[3]; Component of c subunit complex^[2]^[3]; ATP synthase, F0 complex^[2]^[3]; ATP synthase^[2]^[3] ATP synthase subunit c, membrane-bound, F0 sector; DCCD-binding^[4]
Product Synonyms(s)	F0 sector of membrane-bound ATP synthase, subunit c^[1], B3737^[2]^[1], UncE^[2]^[1], PapH^[2]^[1], AtpE^[2]^[1], dicyclohexylcarbodiimide-binding protein^[2]^[1], lipid-binding protein^[2]^[1], c chain^[2]^[1] , ECK3730, JW3715, papH, uncE, b3737
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): atpBEFHAGDC^[2], atpIBEFHAGDC^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	atpE
Mnemonic	ATP
Synonyms	ECK3730, b3737, JW3715, papH, uncE^[1], uncE
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	84.47 minutes	MG1655: 3919212..3918973 <gbrowseImage> name=NC_000913:3918973..3919212 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3881555..3881316 <gbrowseImage> name=NC_012967:3881316..3881555 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3807306..3807545 <gbrowseImage> name=NC_012759:3807306..3807545 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3715492..3715731 <gbrowseImage> name=NC_007779:3715492..3715731 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4016796..4016557 <gbrowseImage> name=NC_010473:4016557..4016796 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3918973	Edman degradation	PMID:6256167 PMID:6446460
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
atpEL31F		L31F	In uncE408 and uncE463; unable to assemble in the membrane			seeded from UniProt:P68699
atpEI28V		I28V	In DC1; has a functional F0 as well as F1 part. However, the ATPase activity is inhibited			seeded from UniProt:P68699
atpEG23D		G23D	In uncE429; unable to assemble in the membrane			seeded from UniProt:P68699
ΔatpE (Keio:JW3715)	deletion	deletion		PMID:16738554	Shigen CGSC10716^[5]
atpED61G		D61G	In DG 7/1; contains an enzymatically active F1 component, but no functional F0 component			seeded from UniProt:P68699
atpE::Tn5KAN-I-SceI (FB21426)	Insertion at nt 185 in Plus orientation			PMID:15262929	E. coli Genome Project:FB21426	contains pKD46
atpE429					CGSC:7166
ΔatpE766::kan				PMID:16738554	CGSC:100142
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3715	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGAAAACCTGAATATGGATCT Primer 2:CCgGCGACAGCGAACATCACGTA
2A1	Kohara Phage	Genobase	PMID:3038334
zid-501::Tn10	Linked marker	CAG18499 = CGSC7458^[5]	est. P1 cotransduction: 14% ^[6]
rbsD296::Tn10	Linked marker	CAG18501 = CGSC7460^[5]	est. P1 cotransduction: 69% ^[6] Synonyms:zie-296::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10102	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10102	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000098	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948253	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0100	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012220	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	AtpE
Synonyms	F0 sector of membrane-bound ATP synthase, subunit c^[1], B3737^[2]^[1], UncE^[2]^[1], PapH^[2]^[1], AtpE^[2]^[1], dicyclohexylcarbodiimide-binding protein^[2]^[1], lipid-binding protein^[2]^[1], c chain^[2]^[1] , ECK3730, JW3715, papH, uncE, b3737
Product description	ATP synthase, F0 complex, c subunit^[2]^[3]; Component of c subunit complex^[2]^[3]; ATP synthase, F0 complex^[2]^[3]; ATP synthase^[2]^[3] ATP synthase subunit c, membrane-bound, F0 sector; DCCD-binding^[4]
EC number (for enzymes)	3.6.3.14^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0016021	integral to membrane	PMID:2863271	IDA: Inferred from Direct Assay		C	Seeded from Riley et al 2006 ^[1].	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
Contributes to	GO:0046961	proton-transporting ATPase activity, rotational mechanism	PMID:2863271	IMP: Inferred from Mutant Phenotype		F		complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045263	proton-transporting ATP synthase complex, coupling factor F(o)	PMID:6460031	IMP: Inferred from Mutant Phenotype		C		complete
	GO:0008289	lipid binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0446	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015078	hydrogen ion transmembrane transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000454	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015078	hydrogen ion transmembrane transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002379	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015078	hydrogen ion transmembrane transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005953	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000454	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002379	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005953	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045263	proton-transporting ATP synthase complex, coupling factor F(o)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000454	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045263	proton-transporting ATP synthase complex, coupling factor F(o)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005953	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045263	proton-transporting ATP synthase complex, coupling factor F(o)	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0138	C	Seeded from EcoCyc (v14.0)	complete
	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01396	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes
Protein	Subunits of c subunit complex	could be indirect
Protein	Subunits of ATP synthase, F0 complex	could be indirect
Protein	Subunits of ATP synthase	could be indirect
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source
plasma membrane	C-terminus localized to the periplasm with 2 predicted transmembrane domains	Daley et al. (2005) ^[7]
plasma membrane			From EcoCyc^[3]
Inner Membrane		PMID:9237612	EchoLocation:atpE
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MENLNMDLLY MAAAVMMGLA AIGAAIGIGI LGGKFLEGAA RQPDLIPLLR TQFFIVMGLV DAIPMIAVGL GLYVMFAVA
Length	79
Mol. Wt	8.256 kDa
pI	4.3 (calculated)
Extinction coefficient	2,980 (calc based on 2 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	8..77	PF00137 ATP synthase subunit C		PMID:19920124
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=atpE taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131605	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948253	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012220	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P68699	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10102	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10102	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948253	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000098	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0100	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	4.18E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	112959	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	23624	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	38617	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
atpBEFHAGDC
atpIBEFHAGDC
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:3919192..3919232 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3737 (EcoliWiki Page)	NCBI GEO profiles for atpE
microarray	GenExpDB:b3737 (EcoliWiki Page)	Summary of data for atpE from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to atpE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10102	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0100	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3737
EcoGene	EcoGene:EG10102	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000098	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012220	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	ATPE	From SHIGELLACYC
E. coli O157	ATPE	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00137 ATP synthase subunit C
Superfamily (EcoliWiki Page)	SUPERFAMILY:81333
EcoCyc	EcoCyc:EG10102	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10102	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000098	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0100	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012220	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 ^1.15 ^1.16 ^1.17 ^1.18 ^1.19 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 ^2.17 ^2.18 ^2.19 ^2.20 ^2.21 ^2.22 ^2.23 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 ^3.7 ^3.8 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed

atpE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to atpE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search