atpE:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
atpE |
|---|---|
| Gene Synonym(s) |
ECK3730, b3737, JW3715, papH, uncE[1], uncE |
| Product Desc. |
ATP synthase, F0 complex, c subunit[2][3]; Component of c subunit complex[2][3]; ATP synthase, F0 complex[2][3]; ATP synthase[2][3] ATP synthase subunit c, membrane-bound, F0 sector; DCCD-binding[4] |
| Product Synonyms(s) |
F0 sector of membrane-bound ATP synthase, subunit c[1], B3737[2][1], UncE[2][1], PapH[2][1], AtpE[2][1], dicyclohexylcarbodiimide-binding protein[2][1], lipid-binding protein[2][1], c chain[2][1] , ECK3730, JW3715, papH, uncE, b3737 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): atpBEFHAGDC[2], atpIBEFHAGDC[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
atpE |
|---|---|
| Mnemonic |
ATP |
| Synonyms |
ECK3730, b3737, JW3715, papH, uncE[1], uncE |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
84.47 minutes |
MG1655: 3919212..3918973 |
||
|
NC_012967: 3881555..3881316 |
||||
|
NC_012759: 3807306..3807545 |
||||
|
W3110 |
|
W3110: 3715492..3715731 |
||
|
DH10B: 4016796..4016557 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3918973 |
Edman degradation |
PMID:6256167 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
atpEL31F |
L31F |
In uncE408 and uncE463; unable to assemble in the membrane |
seeded from UniProt:P68699 | ||||
|
atpEI28V |
I28V |
In DC1; has a functional F0 as well as F1 part. However, the ATPase activity is inhibited |
seeded from UniProt:P68699 | ||||
|
atpEG23D |
G23D |
In uncE429; unable to assemble in the membrane |
seeded from UniProt:P68699 | ||||
|
ΔatpE (Keio:JW3715) |
deletion |
deletion |
PMID:16738554 |
||||
|
atpED61G |
D61G |
In DG 7/1; contains an enzymatically active F1 component, but no functional F0 component |
seeded from UniProt:P68699 | ||||
|
atpE::Tn5KAN-I-SceI (FB21426) |
Insertion at nt 185 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
atpE429 |
|||||||
|
ΔatpE766::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3715 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGAAAACCTGAATATGGATCT Primer 2:CCgGCGACAGCGAACATCACGTA | |
|
Kohara Phage |
PMID:3038334 | ||
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [6] | |
|
Linked marker |
est. P1 cotransduction: 69% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000098 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0100 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012220 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
AtpE |
|---|---|
| Synonyms |
F0 sector of membrane-bound ATP synthase, subunit c[1], B3737[2][1], UncE[2][1], PapH[2][1], AtpE[2][1], dicyclohexylcarbodiimide-binding protein[2][1], lipid-binding protein[2][1], c chain[2][1] , ECK3730, JW3715, papH, uncE, b3737 |
| Product description |
ATP synthase, F0 complex, c subunit[2][3]; Component of c subunit complex[2][3]; ATP synthase, F0 complex[2][3]; ATP synthase[2][3] ATP synthase subunit c, membrane-bound, F0 sector; DCCD-binding[4] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016021 |
integral to membrane |
PMID:2863271 |
IDA: Inferred from Direct Assay |
C |
Seeded from Riley et al 2006 [1]. |
complete | ||
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0046961 |
proton-transporting ATPase activity, rotational mechanism |
PMID:2863271 |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
PMID:6460031 |
IMP: Inferred from Mutant Phenotype |
C |
complete | |||
|
GO:0008289 |
lipid binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0446 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015078 |
hydrogen ion transmembrane transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000454 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015078 |
hydrogen ion transmembrane transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002379 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015078 |
hydrogen ion transmembrane transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005953 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015986 |
ATP synthesis coupled proton transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000454 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015986 |
ATP synthesis coupled proton transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002379 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0015986 |
ATP synthesis coupled proton transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005953 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000454 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005953 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0138 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046933 |
hydrogen ion transporting ATP synthase activity, rotational mechanism |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01396 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of c subunit complex |
could be indirect |
||
|
Protein |
Subunits of ATP synthase, F0 complex |
could be indirect |
||
|
Protein |
Subunits of ATP synthase |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized to the periplasm with 2 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
|
plasma membrane |
From EcoCyc[3] |
|||
|
Inner Membrane |
PMID:9237612 |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MENLNMDLLY MAAAVMMGLA AIGAAIGIGI LGGKFLEGAA RQPDLIPLLR TQFFIVMGLV DAIPMIAVGL GLYVMFAVA |
| Length |
79 |
| Mol. Wt |
8.256 kDa |
| pI |
4.3 (calculated) |
| Extinction coefficient |
2,980 (calc based on 2 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0012220 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000098 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0100 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
4.18E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
112959 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
23624 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
38617 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3919192..3919232
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for atpE | |
|
microarray |
Summary of data for atpE from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to atpE Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0100 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000098 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012220 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
ATPE |
From SHIGELLACYC |
|
E. coli O157 |
ATPE |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10102 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000098 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0100 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012220 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories



