{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	atpC
Gene Synonym(s)	ECK3724, b3731, JW3709, papG, uncC, unc^[1]
Product Desc.	ATP synthase, F1 complex, ε subunit^[2]^[3]; Component of ATP synthase, F1 complex^[2]^[3]; ATP synthase^[2]^[3] ATP synthase subunit epsilon, membrane-bound, F1 sector^[4]
Product Synonyms(s)	F1 sector of membrane-bound ATP synthase, epsilon subunit^[1], B3731^[2]^[1], Unc^[2]^[1], UncC^[2]^[1], PapG^[2]^[1], AtpC^[2]^[1] , ECK3724, JW3709, papG, uncC, b3731
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): atpBEFHAGDC^[2], atpIBEFHAGDC^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	atpC
Mnemonic	ATP
Synonyms	ECK3724, b3731, JW3709, papG, uncC, unc^[1]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	84.35 minutes	MG1655: 3913995..3913576 <gbrowseImage> name=NC_000913:3913576..3913995 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3876338..3875919 <gbrowseImage> name=NC_012967:3875919..3876338 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3801909..3802328 <gbrowseImage> name=NC_012759:3801909..3802328 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3720709..3721128 <gbrowseImage> name=NC_007779:3720709..3721128 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4011579..4011160 <gbrowseImage> name=NC_010473:4011160..4011579 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3913579	Edman degradation	PMID:9868784
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability	Comments
atpC(del) (Keio:JW3709)	deletion	deletion	PMID:16738554	Shigen CGSC10711^[5]
atpC::Tn5KAN-I-SceI (FB21421)	Insertion at nt 369 in Minus orientation		PMID:15262929	E. coli Genome Project:FB21421	contains pKD46
atpC::Tn5KAN-I-SceI (FB21422)	Insertion at nt 369 in Minus orientation		PMID:15262929	E. coli Genome Project:FB21422	does not contain pKD46
atpC424				CGSC:7160
atpC760(del)::kan			PMID:16738554	CGSC:100138
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3709	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGCAATGACTTACCACCTGGA Primer 2:CCCATCGCTTTTTTGGTCAACTC
2A1	Kohara Phage	Genobase	PMID:3038334
7A1	Kohara Phage	Genobase	PMID:3038334
zid-501::Tn10	Linked marker	CAG18499 = CGSC7458^[5]	est. P1 cotransduction: 19% ^[6]
rbsD296::Tn10	Linked marker	CAG18501 = CGSC7460^[5]	est. P1 cotransduction: 56% ^[6] Synonyms:zie-296::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10100	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10100	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000096	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948245	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0098	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012206	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	AtpC
Synonyms	F1 sector of membrane-bound ATP synthase, epsilon subunit^[1], B3731^[2]^[1], Unc^[2]^[1], UncC^[2]^[1], PapG^[2]^[1], AtpC^[2]^[1] , ECK3724, JW3709, papG, uncC, b3731
Product description	ATP synthase, F1 complex, ε subunit^[2]^[3]; Component of ATP synthase, F1 complex^[2]^[3]; ATP synthase^[2]^[3] ATP synthase subunit epsilon, membrane-bound, F1 sector^[4]
EC number (for enzymes)	3.6.3.14^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005524	ATP binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00530	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
Contributes to	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	PMID:2863270	IDA: Inferred from Direct Assay		F		complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045261	proton-transporting ATP synthase complex, catalytic core F(1)	PMID:6238948	IDA: Inferred from Direct Assay		C	Component of F1 ATPase complex, with gene products of uncA (alpha), uncD (beta), uncG (gamma) and uncH (delta) - for review see Chapter 19 of Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd Edition.	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001469	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020546	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015986	ATP synthesis coupled proton transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020547	P	Seeded from EcoCyc (v14.0)	complete
	GO:0019898	extrinsic to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9903	C	Seeded from EcoCyc (v14.0)	complete
	GO:0042777	plasma membrane ATP synthesis coupled proton transport	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00530	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045261	proton-transporting ATP synthase complex, catalytic core F(1)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001469	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045261	proton-transporting ATP synthase complex, catalytic core F(1)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020546	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045261	proton-transporting ATP synthase complex, catalytic core F(1)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020547	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045261	proton-transporting ATP synthase complex, catalytic core F(1)	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0139	C	Seeded from EcoCyc (v14.0)	complete
	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00530	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001469	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020546	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046933	hydrogen ion transporting ATP synthase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020547	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046961	proton-transporting ATPase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001469	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046961	proton-transporting ATPase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020546	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046961	proton-transporting ATPase activity, rotational mechanism	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020547	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of ATP synthase, F1 complex	could be indirect
Protein	rpmB		PMID:16606699	Experiment(s):EBI-1146601
Protein	yjhR		PMID:16606699	Experiment(s):EBI-1146601
Protein	atpD		PMID:19402753	LCMS(ID Probability):99.6
Protein	atpA		PMID:19402753	LCMS(ID Probability):99.6
Protein	Subunits of ATP synthase	could be indirect epsilon (AtpC) & delta (AtpH) are not required for F0 assembly, whereas alpha, beta and gamma from F1 are essential assembly. See PMID:6238948 (Fig 4) for epsilon, PMID:6294057 (Fig 2) for delta.
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Evidence	Reference/Source
plasma membrane		From EcoCyc^[3]
Cytoplasm	PMID:9868784	EchoLocation:atpC
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MAMTYHLDVV SAEQQMFSGL VEKIQVTGSE GELGIYPGHA PLLTAIKPGM IRIVKQHGHE EFIYLSGGIL EVQPGNVTVL ADTAIRGQDL DEARAMEAKR KAEEHISSSH GDVDYAQASA ELAKAIAQLR VIELTKKAM
Length	139
Mol. Wt	15.067 kDa
pI	5.6 (calculated)
Extinction coefficient	5,960 (calc based on 4 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0A6E6
Domain	88..135	PF00401 ATP synthase, Delta/Epsilon chain, long alpha-helix domain		PMID:19920124
Domain	5..84	PF02823 ATP synthase, Delta/Epsilon chain, beta-sandwich domain		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=atpC taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131599	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948245	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012206	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A6E6	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10100	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10100	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948245	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000096	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0098	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	4.18E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	0.15+/-0.043	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	1.237470167	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	12695	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3640	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	5425	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
atpBEFHAGDC
atpIBEFHAGDC
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:3913975..3914015 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3731 (EcoliWiki Page)	NCBI GEO profiles for atpC
microarray	GenExpDB:b3731 (EcoliWiki Page)	Summary of data for atpC from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to atpC Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10100	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0098	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3731
EcoGene	EcoGene:EG10100	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000096	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012206	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000018565 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000024322 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00025661 (score: 1.000; bootstrap: 100%) WBGene00025660 (score: 0.460)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00019061 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0028342 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	P69444 (score: 1.000; bootstrap: 100%) P69446 (score: 1.000; bootstrap: 100%) P69445 (score: 1.000; bootstrap: 100%) P69443 (score: 1.000; bootstrap: 100%) Q6L393 (score: 0.981) Q6ENV7 (score: 0.981) P00835 (score: 0.981) Q6QY69 (score: 0.968) Q6QY05 (score: 0.968) P12086 (score: 0.968) Q6ENG8 (score: 0.968) Q8S6F4 (score: 0.963)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPBC13E74 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000002474 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	ATPC	From SHIGELLACYC
E. coli O157	ATPC	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF02823 ATP synthase, Delta/Epsilon chain, beta-sandwich domain
Pfam (EcoliWiki Page)	PF00401 ATP synthase, Delta/Epsilon chain, long alpha-helix domain
Superfamily (EcoliWiki Page)	SUPERFAMILY:46604
Superfamily (EcoliWiki Page)	SUPERFAMILY:51344
Panther (EcoliWiki Page)	PTHR13822:SF2
EcoCyc	EcoCyc:EG10100	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10100	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000096	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0098	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012206	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 ^2.17 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

atpC:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to atpC Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search