adhE:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

adhE

Gene Synonym(s)

ECK1235, b1241, JW1228, adhC, ana[1], ana

Product Desc.

AdhE[2][3];

Component of ADHE-CPLX[2]

Alcohol dehydrogenase, largely anaerobic; aerobic antioxidant; acetaldehyde-CoA dehydrogenase, CoA-linked; allyl alcohol resistance[4]

Product Synonyms(s)

fused acetaldehyde-CoA dehydrogenase[1], iron-dependent alcohol dehydrogenase[1], pyruvate-formate lyase deactivase[1], B1241[2][1], AdhC[2][1], Ana[2][1], AdhE[2][1] , adhC, ana, ECK1235, JW1228, b1241

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): adhE[2], OP00278

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


The reported PFL deactivase activity of AdhE (Kessler, 1991, 1992) could not be reproduced (Nnyepi, 2007).[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

adhE

Mnemonic

Alcohol/acetaldehyde dehydrogenase

Synonyms

ECK1235, b1241, JW1228, adhC, ana[1], ana

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

27.9 minutes 

MG1655: 1297344..1294669
<gbrowseImage> name=NC_000913:1294669..1297344 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1296914..1294239
<gbrowseImage> name=NC_012967:1294239..1296914 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1184167..1186842
<gbrowseImage> name=NC_012759:1184167..1186842 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1299698..1297023
<gbrowseImage> name=NC_007779:1297023..1299698 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 1337585..1334910
<gbrowseImage> name=NC_010473:1334910..1337585 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1294672

Edman degradation

PMID:2015910
PMID:2695398


<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔadhE (Keio:JW1228)

deletion

deletion

PMID:16738554

Shigen
CGSC9113[5]

adhE::Tn5KAN-2 (FB20272)

Insertion at nt 1923 in Plus orientation

PMID:15262929

E. coli Genome Project:FB20272

does not contain pKD46

ΔadhE::kan

deletion

Biolog:respiration

unable to respire D-Mannose

PMID:16095938

ana-1

CGSC:5096

adhE80

PMID:6986356

CGSC:7028

adhE1

PMID:6752127

CGSC:7285

adhE16(ts)

temperature sensitive

CGSC:7289

adhE2

PMID:6752127

CGSC:7457

ana-2

adhE

CGSC:14693

adhE36

PMID:3550385

CGSC:92529

adhE38

PMID:3550385

CGSC:92530

ΔadhE748::kan

PMID:16738554

CGSC:99914


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1228

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGCTGTTACTAATGTCGCTGA

Primer 2:CCAGCGGATTTTTTCGCTTTTTT

4D8

Kohara Phage

Genobase

PMID:3038334

3D5

Kohara Phage

Genobase

PMID:3038334

fadR13::Tn10

Linked marker

CAG18497 = CGSC7365[5]

est. P1 cotransduction: 4% [6]

oppC506::Tn10

Linked marker

CAG12169 = CGSC7369[5]

est. P1 cotransduction: 73% [6]
Synonyms:zch-506::Tn10, zci-506::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10031

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10031

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000028

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945837

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0030

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004164

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

AdhE

Synonyms

fused acetaldehyde-CoA dehydrogenase[1], iron-dependent alcohol dehydrogenase[1], pyruvate-formate lyase deactivase[1], B1241[2][1], AdhC[2][1], Ana[2][1], AdhE[2][1] , adhC, ana, ECK1235, JW1228, b1241

Product description

AdhE[2][3];

Component of ADHE-CPLX[2]

Alcohol dehydrogenase, largely anaerobic; aerobic antioxidant; acetaldehyde-CoA dehydrogenase, CoA-linked; allyl alcohol resistance[4]

EC number (for enzymes)

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005737

cytoplasm

C

Seeded from Riley et al 2006 [1].

Missing: evidence, reference

GO:0004022

alcohol dehydrogenase (NAD) activity

PMID:6998946

IMP: Inferred from Mutant Phenotype

F

complete

GO:0004022

alcohol dehydrogenase (NAD) activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012079

F

Seeded from EcoCyc (v14.0)

complete

GO:0008774

acetaldehyde dehydrogenase (acetylating) activity

PMID:6998946

IMP: Inferred from Mutant Phenotype

F

complete

GO:0004022

alcohol dehydrogenase (NAD) activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:1.1.1.1

F

Seeded from EcoCyc (v14.0)

complete

GO:0005506

iron ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0408

F

Seeded from EcoCyc (v14.0)

complete

GO:0005829

cytosol

PMID:16858726

IDA: Inferred from Direct Assay

C

Seeded from EcoCyc (v14.0)

complete

GO:0006066

alcohol metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012079

P

Seeded from EcoCyc (v14.0)

complete

GO:0008774

acetaldehyde dehydrogenase (acetylating) activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012079

F

Seeded from EcoCyc (v14.0)

complete

GO:0008774

acetaldehyde dehydrogenase (acetylating) activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:1.2.1.10

F

Seeded from EcoCyc (v14.0)

complete

GO:0015976

carbon utilization

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012079

P

Seeded from EcoCyc (v14.0)

complete

GO:0016020

membrane

PMID:16858726

IDA: Inferred from Direct Assay

C

Seeded from EcoCyc (v14.0)

complete

GO:0046872

metal ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001670

F

Seeded from EcoCyc (v14.0)

complete

GO:0046872

metal ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR018211

F

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001670

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012079

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR015590

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016161

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR018211

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0560

P

Seeded from EcoCyc (v14.0)

complete

GO:0006115

ethanol biosynthetic process

PMID:2015910

IDA: Inferred from Direct Assay

P

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

Subunits of ADHE-CPLX

could be indirect

Protein

nadE

PMID:16606699

Experiment(s):EBI-1139291

Protein

lacZ

PMID:16606699

Experiment(s):EBI-1139291

Protein

rpmB

PMID:16606699

Experiment(s):EBI-1139291

Protein

intR

PMID:16606699

Experiment(s):EBI-1139291

Protein

rplB

PMID:16606699

Experiment(s):EBI-1139291

Protein

rsuA

PMID:16606699

Experiment(s):EBI-1139291

Protein

rpsB

PMID:15690043

Experiment(s):EBI-891082

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MAVTNVAELN ALVERVKKAQ REYASFTQEQ VDKIFRAAAL AAADARIPLA KMAVAESGMG
IVEDKVIKNH FASEYIYNAY KDEKTCGVLS EDDTFGTITI AEPIGIICGI VPTTNPTSTA
IFKSLISLKT RNAIIFSPHP RAKDATNKAA DIVLQAAIAA GAPKDLIGWI DQPSVELSNA
LMHHPDINLI LATGGPGMVK AAYSSGKPAI GVGAGNTPVV IDETADIKRA VASVLMSKTF
DNGVICASEQ SVVVVDSVYD AVRERFATHG GYLLQGKELK AVQDVILKNG ALNAAIVGQP
AYKIAELAGF SVPENTKILI GEVTVVDESE PFAHEKLSPT LAMYRAKDFE DAVEKAEKLV
AMGGIGHTSC LYTDQDNQPA RVSYFGQKMK TARILINTPA SQGGIGDLYN FKLAPSLTLG
CGSWGGNSIS ENVGPKHLIN KKTVAKRAEN MLWHKLPKSI YFRRGSLPIA LDEVITDGHK
RALIVTDRFL FNNGYADQIT SVLKAAGVET EVFFEVEADP TLSIVRKGAE LANSFKPDVI
IALGGGSPMD AAKIMWVMYE HPETHFEELA LRFMDIRKRI YKFPKMGVKA KMIAVTTTSG
TGSEVTPFAV VTDDATGQKY PLADYALTPD MAIVDANLVM DMPKSLCAFG GLDAVTHAME
AYVSVLASEF SDGQALQALK LLKEYLPASY HEGSKNPVAR ERVHSAATIA GIAFANAFLG
VCHSMAHKLG SQFHIPHGLA NALLICNVIR YNANDNPTKQ TAFSQYDRPQ ARRRYAEIAD
HLGLSAPGDR TAAKIEKLLA WLETLKAELG IPKSIREAGV QEADFLANVD KLSEDAFDDQ
CTGANPRYPL ISELKQILLD TYYGRDYVEG ETAAKKEAAP AKAEKKAKKS A
Length

891

Mol. Wt

96.129 kDa

pI

6.8 (calculated)

Extinction coefficient

69,220 - 70,345 (calc based on 28 Y, 5 W, and 9 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Initiator Methionine

1

Removed

UniProt:P0A9Q7

Domain

1..406

PF00171 Aldehyde dehydrogenase family

PMID:19920124

Domain

457..854

PF00465 Iron-containing alcohol dehydrogenase

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=adhE taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129202

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945837

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004164

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0A9Q7

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10031

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10031

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945837

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000028

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0030

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

5.43E+03

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

E. coli K-12 MG1655

3485

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

4687

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

3197

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

adhE

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1297324..1297364 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1241 (EcoliWiki Page)

NCBI GEO profiles for adhE

microarray

GenExpDB:b1241 (EcoliWiki Page)

Summary of data for adhE from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (1297274..1297865) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ04; Well:B3[7]

<protect></protect>

Notes

Accessions Related to adhE Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10031

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0030

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1241

EcoGene

EcoGene:EG10031

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000028

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004164

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Apis mellifera

  • ENSAPMP00000018765 (score: 1.000; bootstrap: 100%)
  • ENSAPMP00000023197 (score: 0.222)
  • YP_026233 (score: 0.172)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000005874 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.144)

From Inparanoid:20070104

Caenorhabditis briggsae

  • YP_026233 (score: 0.255)
  • WBGene00025759 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Caenorhabditis elegans

  • YP_026233 (score: 0.250)
  • WBGene00012608 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000010872 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.147)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000009349 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.153)

From Inparanoid:20070104

Danio rerio

  • YP_026233 (score: 0.216)
  • ZDB-GENE-040426-2070 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-040425-3017 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • YP_026233 (score: 1.000; bootstrap: 96%)
  • DDB0219524 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • YP_026233 (score: 0.250)
  • FBgn0017482 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • YP_026233 (score: 1.000; bootstrap: 87%)
  • GA17444-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000276576 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.228)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000001187 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.205)

From Inparanoid:20070104

Mus musculus

  • MGI:1923437 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.225)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000034755 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.300)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000009462 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.228)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000181441 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.200)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00008613001 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.240)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000050261 (score: 1.000; bootstrap: 100%)
  • YP_026233 (score: 0.177)

From Inparanoid:20070104

Shigella flexneri

ADHE

From SHIGELLACYC

E. coli O157

ADHE

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00465 Iron-containing alcohol dehydrogenase

Pfam (EcoliWiki Page)

PF00171 Aldehyde dehydrogenase family

Superfamily (EcoliWiki Page)

SUPERFAMILY:53720

Superfamily (EcoliWiki Page)

SUPERFAMILY:56796

EcoCyc

EcoCyc:EG10031

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10031

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000028

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0030

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004164

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]