rep:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Data loaded by TableEdit_Loader. |
||
| Line 334: | Line 334: | ||
| | | | ||
unable to respire [[Carbon sources|L-Asparagine]] | unable to respire [[Carbon sources|L-Asparagine]] | ||
| | |||
PMID:16095938 | |||
| | |||
| | |||
|- | |||
| | |||
Δrep::kan | |||
| | |||
deletion | |||
| | |||
| | |||
[[Biolog]]:respiration | |||
| | |||
unable to respire [[Carbon sources|L-Aspartate]] | |||
| | | | ||
PMID:16095938 | PMID:16095938 | ||
| Line 435: | Line 452: | ||
[[Biolog]]:respiration | [[Biolog]]:respiration | ||
| | | | ||
unable to respire [[Carbon sources|L- | unable to respire [[Carbon sources|L-Serine]] | ||
| | | | ||
PMID:16095938 | PMID:16095938 | ||
Revision as of 16:58, 26 April 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rep |
|---|---|
| Mnemonic |
Replicase |
| Synonyms | |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.32 minutes |
MG1655: 3958700..3960721 |
||
|
NC_012967: 3922479..3924500 |
||||
|
W3110 |
|
W3110: 3676004..3673983 |
||
|
DH10B: 4057620..4059641 |
||||
|
NC_012759: 3848369..3850390 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δrep (Keio:JW5604) |
deletion |
deletion |
|||||
|
At position 508 in Minus orientation, contains plasmid pKD46. | |||||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
rep-5 |
|||||||
|
rep-3 |
|||||||
|
rep-142(ts) |
temperature sensitive |
||||||
|
[rep-71] |
null allele | ||||||
|
Δrep-729::kan |
|||||||
|
Δrep::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
| |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5604 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCCGTCTAAACCCCGGCCAACA Primer 2:CCTTTCCCTCGTTTTGCCGCCAT | |
|
Linked marker |
est. P1 cotransduction: 83% [10] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 10% [10] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Takahashi, S et al. (1979) The rep mutation. VI. Purification and properties of the Escherichia coli rep protein, DNA helicase III. Can. J. Biochem. 57 855-66 PubMed
- ↑ Tessman, I et al. (1982) Relative map location of the rep and rho genes of Escherichia coli. J. Bacteriol. 151 1637-40 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).