ompA:Gene: Difference between revisions
Adding section & Genetic interactions table to Gene pages. |
Edited by wikibot |
||
| Line 78: | Line 78: | ||
MG1655: 1019276..1018236<br /><gbrowseImage> | MG1655: 1019276..1018236<br /><gbrowseImage> | ||
name=NC_000913:1018236..1019276 | name=NC_000913:1018236..1019276 | ||
source= | source=MG1655 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
| Line 129: | Line 129: | ||
W3110: 1020475..1019435<br /><gbrowseImage> | W3110: 1020475..1019435<br /><gbrowseImage> | ||
name=AC_000091:1019435..1020475 | name=AC_000091:1019435..1020475 | ||
source= | source=MG1655_W3110 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
| Line 145: | Line 145: | ||
DH10B: 1073204..1072164<br /><gbrowseImage> | DH10B: 1073204..1072164<br /><gbrowseImage> | ||
name=NC_010473:1072164..1073204 | name=NC_010473:1072164..1073204 | ||
source= | source=MG1655_DH10B | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
Revision as of 22:13, 24 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompA |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK0948, b0957, JW0940, con, tolG, tut[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.95 minutes |
MG1655: 1019276..1018236 |
||
|
NC_012967: 1037144..1036104 |
||||
|
NC_012759: 921204..922244 |
||||
|
W3110 |
|
W3110: 1020475..1019435 |
||
|
DH10B: 1073204..1072164 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1018239 |
Edman degradation |
PMID:340230[2] |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔompA (Keio:JW0940) |
deletion |
deletion |
|||||
|
ompA::Tn5KAN-2 (FB20072) |
Insertion at nt 518 in Minus orientation |
does not contain pKD46 | |||||
|
ΔompA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ompA252 |
|||||||
|
ompA256 |
|||||||
|
ΔompA772::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0940 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAAGACAGCTATCGCGAT Primer 2:CCAGCCTGCGGCTGAGTTACAA | |
|
Linked marker |
est. P1 cotransduction: 57% [12] | ||
|
Linked marker |
est. P1 cotransduction: 14% [12] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Schweizer, M et al. (1978) Major proteins of the Escherichia coli outer cell envelope membrane. Interaction of protein II with lipopolysaccharide. Eur. J. Biochem. 82 211-7 PubMed
- ↑ Chen, R et al. (1980) Primary structure of major outer membrane protein II (ompA protein) of Escherichia coli K-12. Proc. Natl. Acad. Sci. U.S.A. 77 4592-6 PubMed
- ↑ Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Molloy, MP et al. (1998) Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 19 837-44 PubMed
- ↑ 7.0 7.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 8.0 8.1 8.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).