{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	ridA
Gene Synonym(s)	ECK4238, b4243, JW5755^[1], JW5755, yjgF
Product Desc.	conserved protein^[2]^[3]; Component of YjgF homotrimer^[3] Function unknown; Salmonella ortholog required for full IlvE activity and for the dependence of the alternative pyrimidine biosynthesis (APB) pathway of thiamine biosynthesis upon the oxidative pentose phosphate pathway; serine sensitivity; trimeric^[4]
Product Synonyms(s)	ketoacid-binding protein^[1], B4243^[2]^[1], YjgF^[2]^[1] , ECK4238, JW5755, b4243
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): yjgF^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

YjgF, RutC, TdcF, YoaB and YjgH are paralogs and members of a highly conserved YjgF family (pfam:PF01042) with diverse mutant phenotypes and unknown molecular function; the family members form homotrimers, some binding 2-ketoglutarate or related compounds. The rat homolog PSP (perchloric acid-soluble protein) has been reported to have endoribonuclease activity, Endoribonuclease L, against ss mRNA, inhibiting translation, but this activity has not been demonstrated for other members.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	ridA
Mnemonic	reactive intermediate/imine deaminase A^[5]
Synonyms	ECK4238, b4243, JW5755^[1], JW5755, yjgF
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	96.31 minutes	MG1655: 4468936..4468550 <gbrowseImage> name=NC_000913:4468550..4468936 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4454190..4453804 <gbrowseImage> name=NC_012967:4453804..4454190 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4407285..4407671 <gbrowseImage> name=NC_012759:4407285..4407671 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4475593..4475207 <gbrowseImage> name=NC_007779:4475207..4475593 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4570744..4570358 <gbrowseImage> name=NC_010473:4570358..4570744 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4468553	Edman degradation	PMID:9298646 PMID:9868784
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔyjgF (Keio:JW5755)	deletion	deletion			PMID:16738554	Shigen
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

In Salmoella, yjgF knockouts suppress the adenine auxotrophy of purF mutants

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW5755	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAGCAAAACTATCGCGACGGA Primer 2:CCGCGACGAACAGCGATCGCTTC
E1F5	Kohara Phage	Genobase	PMID:3038334
zjf-920::Tn10	Linked marker	CAG12019 = CGSC7484^[6]	est. P1 cotransduction: 41% ^[7] Synonyms:zjh-901::Tn10, zjg-920::Tn10
mdoB202::Tn10	Linked marker	CAG18430 = CGSC7488^[6]	est. P1 cotransduction: % ^[7] Synonyms:zjj-202::Tn10, zji-202::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (EcoliWiki Page)	GeneID:948771	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RidA
Synonyms	ketoacid-binding protein^[1], B4243^[2]^[1], YjgF^[2]^[1] , ECK4238, JW5755, b4243
Product description	conserved protein^[2]^[3]; Component of YjgF homotrimer^[3] Function unknown; Salmonella ortholog required for full IlvE activity and for the dependence of the alternative pyrimidine biosynthesis (APB) pathway of thiamine biosynthesis upon the oxidative pentose phosphate pathway; serine sensitivity; trimeric^[4]
EC number (for enzymes)	EC:3.5.99.10
edit table

Notes

Catalytic activity:2-iminobutanoate/2-iminopropanoate deaminase^[8]

2-iminobutanoate + H₂O = 2-oxobutanoate + NH₃

2-iminopropanoate + H₂O = pyruvate + NH₃

"{RidA]accelerates the release of ammonia from reactive enamine/imine intermediates of the PLP-dependent threonine dehydratase (IlvA) in the low water environment of the cell. It catalyzes the deamination of enamine/imine intermediates to yield 2-ketobutyrate and ammonia. It is required for the detoxification of reactive intermediates of IlvA due to their highly nucleophilic abilities."

The RidA ortholog in Salmonella enteric Serotype Typhimurium is Involved in isoleucine biosynthesis in certain growth conditions.^[9]

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	Aspect	Notes	Status
	GO:0016020	membrane	PMID:16858726	IDA: Inferred from Direct Assay	C	Seeded from EcoCyc (v20.5)	complete
	GO:0005829	cytosol	PMID:18304323	IDA: Inferred from Direct Assay	C	Seeded from EcoCyc (v20.5)	complete
	GO:0005829	cytosol	PMID:15911532	IDA: Inferred from Direct Assay	C	Seeded from EcoCyc (v20.5)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of YjgF homotrimer	could be indirect
Protein	rpsM		PMID:19402753	LCMS(ID Probability):99.6
Protein	rraB		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplX		PMID:19402753	LCMS(ID Probability):99.6
Protein	dnaN		PMID:19402753	LCMS(ID Probability):99.6 MALDI(Z-score):8.682030
Protein	rplO		PMID:19402753	LCMS(ID Probability):99.6
Protein	groS		PMID:19402753	MALDI(Z-score):21.758882
Protein	yjjU		PMID:19402753	MALDI(Z-score):31.932864
Protein	bglB		PMID:19402753	LCMS(ID Probability):99.3
Protein	tdcF		PMID:19402753	LCMS(ID Probability):99.6
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSQTFYRCNK GEIMSKTIAT ENAPAAIGPY VQGVDLGNMI ITSGQIPVNP KTGEVPADVA AQARQSLDNV KAIVEAAGLK VGDIVKTTVF VKDLNDFATV NATYEAFFTE HNATFPARSC VEVARLPKDV KIEIEAIAVR R
Length	141
Mol. Wt	15.169 kDa
pI	6.0 (calculated)
Extinction coefficient	4,470 - 4,720 (calc based on 3 Y, 0 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0AF93
Domain	7..127	PF01042 Endoribonuclease L-PSP		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=yjgF taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:90111711	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948771	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AF93	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948771	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	6.54E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	1164.627+/-17.454	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.37501+/-0.01269	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	0.845854922	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	18166	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	12479	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	7473	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
yjgF
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:4468916..4468956 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b4243 (EcoliWiki Page)	NCBI GEO profiles for yjgF
microarray	GenExpDB:b4243 (EcoliWiki Page)	Summary of data for yjgF from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to yjgF Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b4243
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000021077 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000025706 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT3G20390 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000034602 (score: 1.000; bootstrap: 100%) ENSBTAP00000029849 (score: 1.000; bootstrap: 100%) ENSBTAP00000016718 (score: 1.000; bootstrap: 100%) ENSBTAP00000033235 (score: 0.865)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00042416 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00016011 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000000682 (score: 1.000; bootstrap: 100%) ENSCAFP00000012722 (score: 0.119)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040808-30 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040808-33 (score: 1.000; bootstrap: 100%) ZDB-CDNA-051030-9 (score: 0.810) ZDB-CDNA-040718-346 (score: 0.804) ZDB-GENE-040718-315 (score: 0.804)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0169400 (score: 1.000; bootstrap: 98%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0028510 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA13610-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000254878 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000007672 (score: 1.000; bootstrap: 100%) ENSMMUP00000015513 (score: 0.290)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000008154 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:1095401 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000007430 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YER057C (score: 1.000; bootstrap: 100%) YIL051C (score: 0.586)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC10390 (score: 1.000; bootstrap: 100%) SPBC2G24c (score: 0.461)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000171495 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00024883001 (score: 1.000; bootstrap: 100%) GSTENP00017364001 (score: 0.398)	From Inparanoid:20070104
Shigella flexneri	YJGF	From SHIGELLACYC
E. coli O157	YJGF	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:55298
Pfam (EcoliWiki Page)	PF01042 Endoribonuclease L-PSP
EcoCyc	EcoCyc:	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Lambrecht, JA et al. (2012) Conserved YjgF protein family deaminates reactive enamine/imine intermediates of pyridoxal 5'-phosphate (PLP)-dependent enzyme reactions. J. Biol. Chem. 287 3454-61 PubMed
↑ ^6.0 ^6.1 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ UniProtKB
↑ Christopherson, MR et al. (2008) YjgF is required for isoleucine biosynthesis when Salmonella enterica is grown on pyruvate medium. J. Bacteriol. 190 3057-62 PubMed

yjgF:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to yjgF Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search