{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	yacL
Gene Synonym(s)	ECK0118, b0119, JW0115^[1], JW0115
Product Desc.	conserved protein^[2]^[3] Function unknown^[4]
Product Synonyms(s)	conserved protein^[1], B0119^[2]^[1], YacL^[2]^[1] , ECK0118, JW0115, b0119
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): yacL^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	yacL
Mnemonic	Systematic nomenclature
Synonyms	ECK0118, b0119, JW0115^[1], JW0115
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	2.9 minutes	MG1655: 134388..134750 <gbrowseImage> name=NC_000913:134388..134750 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 137191..137553 <gbrowseImage> name=NC_012967:137191..137553 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 134387..134749 <gbrowseImage> name=NC_012759:134387..134749 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 134388..134750 <gbrowseImage> name=NC_007779:134388..134750 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 108492..108854 <gbrowseImage> name=NC_010473:108492..108854 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
yacL::Tn5KAN-I-SceI (FB20015)	Insertion at nt 149 in Minus orientation				PMID:15262929	E. coli Genome Project:FB20015	contains pKD46
yacL(del) (Keio:JW0115)	deletion	deletion			PMID:16738554	Shigen CGSC8397^[5]
yacL(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketoglutarate	PMID:16095938
yacL106(del)::FLK2(lacZ,kan)					PMID:12142427	CGSC:86519
yacL107(del)					PMID:12142427	CGSC:86521
yacL737(del)::kan					PMID:16738554	CGSC:103458
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0115	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGATTACGAATTTCTGCGCGA Primer 2:CCCTTCTGCTGCACGAAATTGCG
4E11	Kohara Phage	Genobase	PMID:3038334
17C11	Kohara Phage	Genobase	PMID:3038334
leuO3051::Tn10	Linked marker	CAG12095 = CGSC7324^[5]	est. P1 cotransduction: 9% ^[6] Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).
zad-220::Tn10	Linked marker	CAG12025 = CGSC7326^[5]	est. P1 cotransduction: 61% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12605	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12605	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:944809	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002328	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2489	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000414	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	YacL
Synonyms	conserved protein^[1], B0119^[2]^[1], YacL^[2]^[1] , ECK0118, JW0115, b0119
Product description	conserved protein^[2]^[3] Function unknown^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	rapA	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	nusA	PMID:15690043^[7]	Experiment(s):EBI-879082
Protein	rplB	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rplC	PMID:15690043^[7]	Experiment(s):EBI-879082
Protein	rplD	PMID:15690043^[7]	Experiment(s):EBI-879082
Protein	rplM	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rplO	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rpoA	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rpoB	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523, EBI-883170
Protein	rpoC	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rpoZ	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rpsB	PMID:15690043^[7]	Experiment(s):EBI-879082
Protein	rpsD	PMID:15690043^[7]	Experiment(s):EBI-879082, EBI-882523
Protein	rpsM	PMID:15690043^[7]	Experiment(s):EBI-879082
Protein	arnA	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	crp	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	elaB	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	fur	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	gltA	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	hfq	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	nuoG	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	pnp	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	proV	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rplN	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rplP	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rplQ	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rplU	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rplV	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpmB	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsA	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsC	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsE	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsF	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsJ	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsK	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsL	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsN	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsT	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rpsU	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	rsuA	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	slyD	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	uspG	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	yqjI	PMID:15690043^[7]	Experiment(s):EBI-882523
Protein	uspG	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	rplN	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	rpsL	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	glpK	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	ykgF	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	glpD	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	zwf	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	mreB	PMID:16606699^[8]	Experiment(s):EBI-1135630
Protein	slyD	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	gltA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	uspG	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	elaB	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplU	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsL	PMID:19402753^[9]	LCMS(ID Probability):99.4
Protein	rplP	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsK	PMID:19402753^[9]	LCMS(ID Probability):99.4
Protein	rplO	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):17.053160
Protein	rpsA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	nuoG	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	fur	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpmB	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsN	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsF	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	gapA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsT	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplN	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplQ	PMID:19402753^[9]	LCMS(ID Probability):99.5
Protein	rplM	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):15.079320
Protein	rpsD	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):17.053160
Protein	rpsU	PMID:19402753^[9]	LCMS(ID Probability):99.5
Protein	rpsJ	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsC	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplB	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):17.053160
Protein	kefA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	pnp	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	hfq	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	yqjI	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	arnA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpoB	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):9.731086
Protein	rpoC	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):9.171032
Protein	crp	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	nusG	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):39.095383
Protein	proV	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpoZ	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):17.053160
Protein	rpoA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):39.255097
Protein	rsuA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rapA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):18.730389
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MAQCDFGALP GAEEHTMDYE FLRDITGVVK VRMSMGHEVV GHWFNEEVKE NLALLDEVEQ AAHALKGSER SWQRAGHEYT LWMDGEEVMV RANQLEFAGD EMEEGMNYYD EESLSLCGVE DFLQVVAAYR NFVQQK
Length	136
Mol. Wt	15.599 kDa
pI	4.2 (calculated)
Extinction coefficient	23,950 - 24,200 (calc based on 5 Y, 3 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	1..118	PF06062 Uncharacterised protein family (UPF0231)		PMID:19920124^[10]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=yacL taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:90111086	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:944809	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000414	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A8E5	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG12605	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12605	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:944809	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002328	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2489	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	3.867+/-0.054	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.100828729	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	1628	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	374	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	1275	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
yacL
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:134368..134408 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0119 (EcoliWiki Page)	NCBI GEO profiles for yacL
microarray	GenExpDB:b0119 (EcoliWiki Page)	Summary of data for yacL from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (134120..134348) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ01; Well:A6^[11]
edit table

Notes

Accessions Related to yacL Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12605	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2489	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0119
EcoGene	EcoGene:EG12605	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002328	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000414	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	YACL	From SHIGELLACYC
E. coli O157	YACL	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF06062 Uncharacterised protein family (UPF0231)
EcoCyc	EcoCyc:EG12605	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12605	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002328	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2489	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000414	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 ^7.28 ^7.29 ^7.30 ^7.31 ^7.32 ^7.33 ^7.34 ^7.35 ^7.36 ^7.37 ^7.38 ^7.39 ^7.40 ^7.41 ^7.42 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^8.0 ^8.1 ^8.2 ^8.3 ^8.4 ^8.5 ^8.6 ^8.7 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 ^9.18 ^9.19 ^9.20 ^9.21 ^9.22 ^9.23 ^9.24 ^9.25 ^9.26 ^9.27 ^9.28 ^9.29 ^9.30 ^9.31 ^9.32 ^9.33 ^9.34 ^9.35 ^9.36 ^9.37 ^9.38 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

yacL:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to yacL Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search