xerC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
xerC |
|---|---|
| Mnemonic |
cer-specific recombination |
| Synonyms |
ECK3806, b3811, JW3784[1], JW3784 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
86.09 minutes, 86.09 minutes |
MG1655: 3994310..3995206 |
||
|
NC_012967: 3958124..3959020 |
||||
|
NC_012759: 3883979..3884875 |
||||
|
W3110 |
|
W3110: 3640394..3639498 |
||
|
DH10B: 4093230..4094126 |
||||
| edit table |
</protect>
Notes
The xerC gene is part of a multicistronic unit, described in Colloms et al. (1990)[2].
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3994310 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔxerC (Keio:JW3784) |
deletion |
deletion |
|||||
|
xerCR243Q |
R243Q |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P6 | ||||
|
xerCY275F |
Y275F |
Abolishes DNA cleavage activity |
seeded from UniProt:P0A8P6 | ||||
|
xerCESS252NHG |
ESS252NHG |
Abolishes chromosomal recombination but not plasmid resolution |
seeded from UniProt:P0A8P6 | ||||
|
xerC2 |
Growth Phenotype |
small colonies on broth-containing plates, slow recovery from stationary phase. Also, "xerC cells in exponential phase show a substantial, but variable # of filaments and an excess of nonfilamentous cells at the 2- cell stage." |
Exponential growth rate in liquid broth culture showed day-to-day variation that varied from 80-100% of an otherwise isogenic xerC+ strain. | ||||
|
xerCY17 |
Growth Phenotype |
small colonies on broth-containing plates, slow recovery from stationary phase. Also, "xerC cells in exponential phase show a substantial, but variable # of filaments and an excess of nonfilamentous cells at the 2- cell stage." |
Exponential growth rate in liquid broth culture showed day-to-day variation that varied from 80-100% of an otherwise isogenic xerC+ strain. | ||||
|
xerC |
Cell Shape |
Filamentation- >15% of cells |
|||||
|
xerC rarA |
Cell Shape |
Filamentation- >15% of cells |
|||||
|
xerC1 |
resolution defective |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3784 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCGATTTACACACCGATGT Primer 2:CCTTTCCCCCGTTTGGCGCGTGG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 17% [12] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 60% [12] | |
|
DS8029 |
Strain |
AB1157xerC |
|
|
GR51 |
Strain |
AB1157xerC ftsK |
|
|
DW1 |
Strain |
AB1157recF lacIq lacPO-xerC recA938 |
|
|
RM40 |
Strain |
AB1157recF lacIq lacPO-xerC |
|
|
pSDC107 |
Plasmid Clone |
XerC+ overexpressing plasmid CmR λdv replicon |
|
|
pSDC105 |
Plasmid Clone |
XerC+ overexpressing plasmid CmR p15a replicon |
|
|
pLA125 |
Plasmid Clone |
XerCR243Q overexpressing plasmid |
|
|
pSDC104 |
Plasmid Clone |
XerC+ overexpressing plasmid |
|
|
pLA121 |
Plasmid Clone |
XerCY275F overexpressing plasmid |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 Colloms, SD et al. (1990) Recombination at ColE1 cer requires the Escherichia coli xerC gene product, a member of the lambda integrase family of site-specific recombinases. J. Bacteriol. 172 6973-80 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Parsons, RL et al. (1988) Step-arrest mutants of FLP recombinase: implications for the catalytic mechanism of DNA recombination. Mol. Cell. Biol. 8 3303-10 PubMed
- ↑ 5.0 5.1 Leslie, NR & Sherratt, DJ (1995) Site-specific recombination in the replication terminus region of Escherichia coli: functional replacement of dif. EMBO J. 14 1561-70 PubMed
- ↑ Pargellis, CA et al. (1988) Suicide recombination substrates yield covalent lambda integrase-DNA complexes and lead to identification of the active site tyrosine. J. Biol. Chem. 263 7678-85 PubMed
- ↑ 7.0 7.1 7.2 Blakely, G et al. (1991) Escherichia coli XerC recombinase is required for chromosomal segregation at cell division. New Biol. 3 789-98 PubMed
- ↑ 8.0 8.1 Sherratt, DJ et al. (2004) Recombination and chromosome segregation. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 359 61-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 CGSC: The Coli Genetics Stock Center
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 13.0 13.1 13.2 Recchia, GD et al. (1999) FtsK-dependent and -independent pathways of Xer site-specific recombination. EMBO J. 18 5724-34 PubMed
- ↑ McCulloch, R et al. (1994) Xer-mediated site-specific recombination at cer generates Holliday junctions in vivo. EMBO J. 13 1844-55 PubMed
- ↑ 15.0 15.1 Blakely, G et al. (1993) Two related recombinases are required for site-specific recombination at dif and cer in E. coli K12. Cell 75 351-61 PubMed
