{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	umuD
Gene Synonym(s)	ECK1171, b1183, JW1172, uvm^[1]
Product Desc.	SOS mutagenesis; error-prone repair; processed to UmuD'; forms complex with UmuC^[2]^[3]; Component of DNA polymerase V^[3] DNA polymerase V subunit, capable of translesion synthesis; inducible mutagenesis; error-prone repair; UmuDC single-stranded binding protein with RecA-coated DNA; intrinsic AP lyase activity^[4]
Product Synonyms(s)	DNA polymerase V, subunit D^[1], B1183^[2]^[1], UmuD^[2]^[1] , ECK1171, JW1172, b1183
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): umuDC^[2], OP00250
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

LexA regulon. Autocleavage removes the first 24 amino acids to form UmuD', required for mutageneic translesion synthesis (TLS). UmuD and UmuD' are intrinsically disordered proteins (IDPs) that can nonetheless form stable dimers (Simon, 2008)^[5].^[4] A monomeric variant of UmuD has been identified that is active for cleavage to form UmuD' and for other functions ^[6].

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	umuD
Mnemonic	UV mutator
Synonyms	ECK1171, b1183, JW1172, uvm^[1]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	26.51 minutes	MG1655: 1229990..1230409 <gbrowseImage> name=NC_000913:1229990..1230409 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1230917..1231336 <gbrowseImage> name=NC_012967:1230917..1231336 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1118711..1119130 <gbrowseImage> name=NC_012759:1118711..1119130 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1232344..1232763 <gbrowseImage> name=NC_007779:1232344..1232763 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1270231..1270650 <gbrowseImage> name=NC_010473:1270231..1270650 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
umuD(del) (Keio:JW1172)	deletion	deletion			PMID:16738554	Shigen CGSC9079^[7]
umuD::Tn5KAN-2 (FB20262)	Insertion at nt 77 in Minus orientation				PMID:15262929	E. coli Genome Project:FB20262	does not contain pKD46
umuDP27D		P27D		In umuD1; non-cleavable			seeded from UniProt:P0AG11
umuDG65R		G65R		In umuD44; non-cleavable			seeded from UniProt:P0AG11
umuDG92D		G92D		In umuD77; non-cleavable			seeded from UniProt:P0AG11
umuD44						CGSC:46689
umuD77						CGSC:46690
umuD1						CGSC:46693
umuD772(del)::kan					PMID:16738554	CGSC:103322
umuDC D8N	decreased levels of the Beta processitvity clamp	D to N	Sensitivity to	There is a decrease in the sensitivity to cold.	PMID:19633075		See Figure 1
(umuDC)595(del)::cat	Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat)		Sensitivity to	Sensitivity toward UV radiation was moderately increased.	PMID:10430924	RW82 7280	See Figure 1.
polB(del)umuDC(del)	Deletion of araD-polB operon and replaced with omega cassette. Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat)		Resistant to	Sensitivity toward UV radiation was increased by 2 to 3 fold.	PMID:10430924		See Figure 1.
(umuDC)595(del)::cat	Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat)		Rate of replication	there was a slight delay in the resumption of DNA replication after exposure to UV radiation.	PMID:10430924	RW82 7280	See Figure 2
polB(del)umuDC(del)	Deletion of araD-polB operon and replaced with omega cassette. Deletion of umuDC operon and replaced with chloramephenicol acetylransferase gene (cat)		rate of replication	There was a significant delay in the resumption of DNA replication after exposure to UV radiation.	PMID:10430924		See Figure 3.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW1172	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTTGTTTATCAAGCCTGCGGA Primer 2:CCGCGCATCGCCTTAACGACGTG
2A3	Kohara Phage	Genobase	PMID:3038334
11G8	Kohara Phage	Genobase	PMID:3038334
zcf-117::Tn10	Linked marker	CAG18463 = CGSC7363^[7]	est. P1 cotransduction: 50% ^[8]
fadR13::Tn10	Linked marker	CAG18497 = CGSC7365^[7]	est. P1 cotransduction: 87% ^[8]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11057	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11057	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001046	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945746	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1050	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003974	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	UmuD
Synonyms	DNA polymerase V, subunit D^[1], B1183^[2]^[1], UmuD^[2]^[1] , ECK1171, JW1172, b1183
Product description	SOS mutagenesis; error-prone repair; processed to UmuD'; forms complex with UmuC^[2]^[3]; Component of DNA polymerase V^[3] DNA polymerase V subunit, capable of translesion synthesis; inducible mutagenesis; error-prone repair; UmuDC single-stranded binding protein with RecA-coated DNA; intrinsic AP lyase activity^[4]
EC number (for enzymes)	3.4.21.-^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006197	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006281	DNA repair	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0234	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0227	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008233	peptidase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0645	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008236	serine-type peptidase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0720	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009432	SOS response	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0742	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016787	hydrolase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0378	F	Seeded from EcoCyc (v14.0)	complete
	GO:0045449	regulation of transcription	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006197	P	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	PMID:2552436	IPI: Inferred from Physical Interaction	EcoliWiki:umuC	F		complete
	GO:0006974	response to DNA damage stimulus	PMID:10760165	IEP: Inferred from Expression Pattern		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of DNA polymerase V	could be indirect
Protein	purE		PMID:16606699	Experiment(s):EBI-1139115
Protein	fldB		PMID:16606699	Experiment(s):EBI-1139115
Protein	fur		PMID:16606699	Experiment(s):EBI-1139115
Protein	insO2		PMID:16606699	Experiment(s):EBI-1139115
Protein	rpsE		PMID:16606699	Experiment(s):EBI-1139115
Protein	ybiA		PMID:16606699	Experiment(s):EBI-1139115
Protein	dnaN (beta clamp)
Protein	RecA
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MLFIKPADLR EIVTFPLFSD LVQCGFPSPA ADYVEQRIDL NQLLIQHPSA TYFVKASGDS MIDGGISDGD LLIVDSAITA SHGDIVIAAV DGEFTVKKLQ LRPTVQLIPM NSAYSPITIS SEDTLDVFGV VIHVVKAMR
Length	139
Mol. Wt	15.063 kDa
pI	4.4 (calculated)
Extinction coefficient	4,470 - 4,595 (calc based on 3 Y, 0 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	55..122	PF00717 Peptidase S24-like		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=umuD taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

NMR structure clarifies the dimer interface ^[9] from the original Xtal structure ^[10].
Hydrogen deuterium exchange experiments show UmuD₂ and UmuD'₂ to be highly dynamic proteins ^[11].

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129146	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945746	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003974	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AG11	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11057	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11057	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945746	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001046	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1050	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MG1655	72	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	27	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	39^a	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
umuDC
edit table

Figure courtesy of RegulonDB

</protect>

Notes

LexA-regulated^[12]

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1229970..1230010 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

UmuD₂ and the UmuD' subunit of the UmuDD' heterodimer are degraded by ClpXP ^[13] ^[14]
UmuD₂ is degraded by Lon protease ^[15]

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1183 (EcoliWiki Page)	NCBI GEO profiles for umuD
microarray	GenExpDB:b1183 (EcoliWiki Page)	Summary of data for umuD from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1229552..1230069) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ20; Well:G11^[16]
edit table

Notes

Accessions Related to umuD Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11057	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1050	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1183
EcoGene	EcoGene:EG11057	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001046	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003974	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Xenopus tropicalis	ENSXETP00000006148 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	UMUD	From SHIGELLACYC
E. coli O157	UMUD	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:51306
Pfam (EcoliWiki Page)	PF00717 Peptidase S24-like
EcoCyc	EcoCyc:EG11057	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11057	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001046	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1050	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003974	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Simon, SM et al. (2008) Regulation of Escherichia coli SOS mutagenesis by dimeric intrinsically disordered umuD gene products. Proc. Natl. Acad. Sci. U.S.A. 105 1152-7 PubMed
↑ Ollivierre, JN et al. (2011) The dimeric SOS mutagenesis protein UmuD is active as a monomer. J. Biol. Chem. 286 3607-17 PubMed
↑ ^7.0 ^7.1 ^7.2 CGSC: The Coli Genetics Stock Center
↑ ^8.0 ^8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Ferentz, AE et al. (1997) Dimerization of the UmuD' protein in solution and its implications for regulation of SOS mutagenesis. Nat. Struct. Biol. 4 979-83 PubMed
↑ Peat, TS et al. (1996) Structure of the UmuD' protein and its regulation in response to DNA damage. Nature 380 727-30 PubMed
↑ Fang, J et al. (2010) Conformational dynamics of the Escherichia coli DNA polymerase manager proteins UmuD and UmuD'. J. Mol. Biol. 398 40-53 PubMed
↑ Caramel, A & Schnetz, K (2000) Antagonistic control of the Escherichia coli bgl promoter by FIS and CAP in vitro. Mol. Microbiol. 36 85-92 PubMed
↑ Neher, SB et al. (2003) Distinct peptide signals in the UmuD and UmuD' subunits of UmuD/D' mediate tethering and substrate processing by the ClpXP protease. Proc. Natl. Acad. Sci. U.S.A. 100 13219-24 PubMed
↑ Gonzalez, M et al. (2000) Subunit-specific degradation of the UmuD/D' heterodimer by the ClpXP protease: the role of trans recognition in UmuD' stability. EMBO J. 19 5251-8 PubMed
↑ Gonzalez, M et al. (1998) Lon-mediated proteolysis of the Escherichia coli UmuD mutagenesis protein: in vitro degradation and identification of residues required for proteolysis. Genes Dev. 12 3889-99 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

umuD:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to umuD Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search