{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	trxA
Gene Synonym(s)	ECK3773, b3781, JW5856, fipA, tsnC, dasC^[1], dasC
Product Desc.	oxidized thioredoxin^[2]^[3] Thioredoxin 1; Trx; with TrxB, also has general chaperone activity; processivity factor for phage T7 gene 5 DNA polymerase^[4]
Product Synonyms(s)	thioredoxin 1^[1], B3781^[2]^[1], DasC^[2]^[1], TsnC^[2]^[1], FipA^[2]^[1], thioredoxin(S)₂^[2]^[1] , dasC, ECK3773, fipA, JW5856, tsnC, b3781
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): trxA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	trxA
Mnemonic	Thioredoxin
Synonyms	ECK3773, b3781, JW5856, fipA, tsnC, dasC^[1], dasC
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	85.43 minutes, 85.43 minutes	MG1655: 3963784..3964113 <gbrowseImage> name=NC_000913:3963784..3964113 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3927561..3927890 <gbrowseImage> name=NC_012967:3927561..3927890 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3853453..3853782 <gbrowseImage> name=NC_012759:3853453..3853782 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3670920..3670591 <gbrowseImage> name=NC_007779:3670591..3670920 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4062704..4063033 <gbrowseImage> name=NC_010473:4062704..4063033 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3963787	Edman degradation	PMID:4883076
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔtrxA (Keio:JW5856)	deletion	deletion			PMID:16738554	Shigen
trxA1(Am)					PMID:337124 PMID:3881756	CGSC:5031	amber (UAG) mutation
ΔtrxA307						CGSC:10957
trxA11(ts)				temperature sensitive	PMID:3881756	CGSC:88597
trxA	deletion		Sensitivity to	increases sensitivity to bicyclomycin	PMID:21357484		fig 2
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW5856	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAGCGATAAAATTATTCACCT Primer 2:CCtGCCAGGTTAGCGTCGAGGAA
7B1	Kohara Phage	Genobase	PMID:3038334
2A8	Kohara Phage	Genobase	PMID:3038334
ilvD500::Tn10	Linked marker	CAG18431 = CGSC7462^[5]	est. P1 cotransduction: 69% ^[6] Synonyms:ilv500::Tn10
metEo-3079::Tn10	Linked marker	CAG18491 = CGSC7464^[5]	est. P1 cotransduction: 14% ^[6] Synonyms:metE3079::Tn10 nnnThe Tn10 in CAG13491 is inserted in the metE regulatory region, but causes a Met- phenotype.
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11031	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11031	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001020	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948289	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1024	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	TrxA
Synonyms	thioredoxin 1^[1], B3781^[2]^[1], DasC^[2]^[1], TsnC^[2]^[1], FipA^[2]^[1], thioredoxin(S)₂^[2]^[1] , dasC, ECK3773, fipA, JW5856, tsnC, b3781
Product description	oxidized thioredoxin^[2]^[3] Thioredoxin 1; Trx; with TrxB, also has general chaperone activity; processivity factor for phage T7 gene 5 DNA polymerase^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology

oxidized thioredoxin

See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0006662	glycerol ether metabolic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005746	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009055	electron carrier activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005746	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015035	protein disulfide oxidoreductase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005746	F	Seeded from EcoCyc (v14.0)	complete
	GO:0022900	electron transport chain	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0249	P	Seeded from EcoCyc (v14.0)	complete
	GO:0044419	interspecies interaction between organisms	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0945	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR005746	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006662	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013766	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015467	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR017936	P	Seeded from EcoCyc (v14.0)	complete
	GO:0045454	cell redox homeostasis	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR017937	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions

oxidized thioredoxin

See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	fdoG	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	pykA	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	acnB	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in detergent, freeze-thaw treatment in Tris-EDTA & total cell lysates
Protein	icd	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA & total cell lysates
Protein	katG	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in detergent
Protein	sodA	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	putA	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	lamB	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in detergent
Protein	rbsB	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	sdaB	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA
Protein	lacZ	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA & total cell lysates
Protein	nrdD	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	nrdA	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	fadB	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	add	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA
Protein	tdk	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	udp	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	sthA	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA & total cell lysates
Protein	ompF	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in detergent
Protein	ompC	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA
Protein	prc	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	glmM	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	flu	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in detergent
Protein	yjiA	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA
Protein	yqaB	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA
Protein	mqo	PMID:15004283^[7]	Interaction isolated from freeze-thaw treatment in Tris-EDTA & total cell lysates
Protein	yebE	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	obgE	PMID:15004283^[7]	Interaction isolated from total cell lysates
Protein	dnaN	PMID:19402753^[8]	MALDI(Z-score):25.219947
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
plasma membrane			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	MRITIILVAP ARAENIGAAA RAMKTMGFSD LRIVDSQAHL EPATRWVAHG SGDIIDNIKV FPTLAESLHD VDFTVATTAR SRAKYHYYAT PVELVPLLEE KSSWMSHAAL VFGREDSGLT NEELALADVL TGVPMVADYP SLNLGQAVMV YCYQLATLIQ QPAKSDATAD QHQLQALRER AMTLLTTLAV ADDIKLVDWL QQRLGLLEQR DTAMLHRLLH DIEKNITK
Length	228
Mol. Wt	25.259 kDa
pI	5.9 (calculated)
Extinction coefficient	25,440 - 25,565 (calc based on 6 Y, 3 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0AA25
Domain	4..107	PF00085 Thioredoxin		PMID:19920124^[9]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=trxA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:67005950	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948289	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012357	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AA25	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11031	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11031	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948289	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001020	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1024	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	2.66E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	375.299+/-5.54	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.18986+/-0.0242	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	1.063829787	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	34622	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	9265	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	14614	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
trxA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3963764..3963804 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3781 (EcoliWiki Page)	NCBI GEO profiles for trxA
microarray	GenExpDB:b3781 (EcoliWiki Page)	Summary of data for trxA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (3963176..3963341) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ18; Well:B9^[10]
edit table

Notes

Accessions Related to trxA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11031	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1024	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3781
EcoGene	EcoGene:EG11031	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001020	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000027639 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000012348 (score: 1.000; bootstrap: 60%)	From Inparanoid:20070104
Arabidopsis thaliana	AT1G03680 (score: 1.000; bootstrap: 90%) AT4G03520 (score: 0.649) AT3G15360 (score: 0.219)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000000014 (score: 1.000; bootstrap: 63%) ENSBTAP00000033144 (score: 0.494)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00031142 (score: 1.000; bootstrap: 55%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00007099 (score: 1.000; bootstrap: 56%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000002247 (score: 1.000; bootstrap: 59%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000013356 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040426-1795 (score: 1.000; bootstrap: 62%) ZDB-CDNA-040425-2735 (score: 1.000; bootstrap: 62%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0185040 (score: 1.000; bootstrap: 49%) DDB0186269 (score: 1.000; bootstrap: 50%) DDB0191909 (score: 1.000; bootstrap: 51%) DDB0217531 (score: 0.064) DDB0231409 (score: 0.051)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0029752 (score: 1.000; bootstrap: 73%) FBgn0040070 (score: 0.198) FBgn0036442 (score: 0.084) FBgn0011761 (score: 0.080)	From Inparanoid:20070104
Drosophila pseudoobscura	GA17324-PA (score: 1.000; bootstrap: 65%) GA16546-PA (score: 0.174) GA12311-PA (score: 0.140)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000020444 (score: 1.000; bootstrap: 56%) ENSGALP00000020443 (score: 0.118)	From Inparanoid:20070104
Homo sapiens	ENSP00000216185 (score: 1.000; bootstrap: 57%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000016897 (score: 1.000; bootstrap: 81%) ENSMMUP00000028455 (score: 0.069)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000000995 (score: 1.000; bootstrap: 64%)	From Inparanoid:20070104
Mus musculus	MGI:1929468 (score: 1.000; bootstrap: 65%)	From Inparanoid:20070104
Oryza gramene	Q9ZP20 (score: 1.000; bootstrap: 81%) Q5NDA6 (score: 0.575) Q9ZP21 (score: 0.575) Q41864 (score: 0.517) Q6H7E4 (score: 0.146) Q7X8R5 (score: 0.129)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000020036 (score: 1.000; bootstrap: 56%) ENSPTRP00000039310 (score: 0.068)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000007537 (score: 1.000; bootstrap: 64%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YLR043C (score: 1.000; bootstrap: 80%) YGR209C (score: 0.674) YCR083W (score: 0.217)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC7D47c (score: 1.000; bootstrap: 68%) SPBC12D127c (score: 0.116)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000134638 (score: 1.000; bootstrap: 70%) NEWSINFRUP00000132572 (score: 0.083) NEWSINFRUP00000171508 (score: 0.070)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00023150001 (score: 1.000; bootstrap: 73%) GSTENP00029198001 (score: 0.056)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000000504 (score: 1.000; bootstrap: 70%)	From Inparanoid:20070104
Shigella flexneri	TRXA	From SHIGELLACYC
E. coli O157	TRXA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:52833
Pfam (EcoliWiki Page)	PF00085 Thioredoxin
EcoCyc	EcoCyc:EG11031	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11031	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001020	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1024	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 Kumar, JK et al. (2004) Proteomic analysis of thioredoxin-targeted proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 101 3759-64 PubMed
↑ Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

trxA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

oxidized thioredoxin

oxidized thioredoxin

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to trxA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search