{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	sulA
Gene Synonym(s)	ECK0949, b0958, JW0941, sfiA, suf^[1]
Product Desc.	suppressor of lon; inhibits cell division and ftsZ ring formation^[2]; SOS cell division inhibitor^[3] Inhibits cell division and ftsZ ring formation; lexA regulon^[4]
Product Synonyms(s)	SOS cell division inhibitor^[1], B0958^[2]^[1], Suf^[2]^[1], SfiA^[2]^[1], SulA^[2]^[1] , ECK0949, JW0941, sfiA, b0958
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): sulA^[2], OP00092
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	sulA
Mnemonic	Suppressor of lon
Synonyms	ECK0949, b0958, JW0941, sfiA, suf^[1]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	21.98 minutes	MG1655: 1020142..1019633 <gbrowseImage> name=NC_000913:1019633..1020142 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1038010..1037501 <gbrowseImage> name=NC_012967:1037501..1038010 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 922601..923110 <gbrowseImage> name=NC_012759:922601..923110 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1021341..1020832 <gbrowseImage> name=NC_007779:1020832..1021341 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1074070..1073561 <gbrowseImage> name=NC_010473:1073561..1074070 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Huisman et al. (1980) established the identity of the map location^[5].

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
sulA(del) (Keio:JW0941)	deletion	deletion			PMID:16738554	Shigen CGSC8943^[6]
sulAL167A		L167A		Slight decrease in degradation by lon protease			seeded from UniProt:P0AFZ5
sulAH169A		H169A		Great decrease in degradation by lon protease			seeded from UniProt:P0AFZ5
sulA::Tn5KAN-2 (FB20073)	Insertion at nt 205 in Minus orientation				PMID:15262929	E. coli Genome Project:FB20073	does not contain pKD46
sulAL83R		L83R		Loss of activity due to loss of ability to bind to ftsZ			seeded from UniProt:P0AFZ5
sulAK87A		K87A		Loss of degradation by lon protease			seeded from UniProt:P0AFZ5
sulAK72A		K72A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR75A		R75A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAE76A		E76A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAH128A		H128A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAI163A		I163A		Slight decrease in degradation by lon protease			seeded from UniProt:P0AFZ5
sulAH164A		H164A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR108A		R108A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAV115A		V115A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAG117A		G117A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAE126A		E126A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR62C,H,S		R62C,H,S		Loss of activity due to loss of ability to bind to ftsZ			seeded from UniProt:P0AFZ5
sulAL67A		L67A		Loss of degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR39A		R39A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR62A		R62A		Loss of degradation by lon protease			seeded from UniProt:P0AFZ5
sulAH98A		H98A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAR105A		R105A		No effect on degradation by lon protease			seeded from UniProt:P0AFZ5
sulAW77A		W77A		Loss of degradation by lon protease			seeded from UniProt:P0AFZ5
sulA1						CGSC:4789
sulA3						CGSC:6265
sulA27						CGSC:9069
sulA28						CGSC:9891
sulA211			Growth Phenotype		PMID:1107802	CGSC:10277	formerly sulA11 mutation may be in the promoter region ^[7]
sulA22						CGSC:14434
sulA24						CGSC:16909
sulA2111						CGSC:30810
sulA366					PMID:7026534	CGSC:44033
sulA773(del)::kan					PMID:16738554	CGSC:103070
sulA		R62S		Loss of function	PMID:8752322
sulA		R62C		Loss of function	PMID:8752322
sulA		R62H		Loss of function	PMID:8752322
sulA		L83R		Loss of function	PMID:8752322
sulA		40			PMID:8752322		loss of SulA production due to the stop codon introduced at position 40.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0941	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTACACTTCAGGCTATGCACA Primer 2:CCATGATACAAATTAGAGTGAAT
E2E5	Kohara Phage	Genobase	PMID:3038334
9B10	Kohara Phage	Genobase	PMID:3038334
zcb-3059::Tn10	Linked marker	CAG12094 = CGSC7358^[6]	est. P1 cotransduction: 54% ^[8]
zcc-282::Tn10	Linked marker	CAG18466 = CGSC7359^[6]	est. P1 cotransduction: 16% ^[8]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10984	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10984	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000973	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947335	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0977	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003244	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	SulA
Synonyms	SOS cell division inhibitor^[1], B0958^[2]^[1], Suf^[2]^[1], SfiA^[2]^[1], SulA^[2]^[1] , ECK0949, JW0941, sfiA, b0958
Product description	suppressor of lon; inhibits cell division and ftsZ ring formation^[2]; SOS cell division inhibitor^[3] Inhibits cell division and ftsZ ring formation; lexA regulon^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000917	barrier septum formation	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0717	P	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	PMID:8752322	IPI: Inferred from Physical Interaction		F	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0032466	negative regulation of cytokinesis	PMID:6087326	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0005515	protein binding	PMID:8752322	IPI: Inferred from Physical Interaction	EcoliWiki:ftsZ	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006281	DNA repair	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0234	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01179	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0227	P	Seeded from EcoCyc (v14.0)	complete
	GO:0007049	cell cycle	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0131	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009276	Gram-negative-bacterium-type cell wall	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004596	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009432	SOS response	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01179	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009432	SOS response	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004596	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009432	SOS response	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0742	P	Seeded from EcoCyc (v14.0)	complete
	GO:0051782	negative regulation of cell division	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01179	P	Seeded from EcoCyc (v14.0)	complete
	GO:0051782	negative regulation of cell division	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR004596	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009432	SOS response	PMID:6998947	IMP: Inferred from Mutant Phenotype		P	Seeded from EcoCyc (v14.0)	complete
	GO:0051782	negative regulation of cell division	PMID:6998947	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0006974	response to DNA damage stimulus	PMID:11967071	IEP: Inferred from Expression Pattern		P		complete
	GO:0005515	protein binding	PMID:8752322	IPI: Inferred from Physical Interaction	EcoliWiki: ftsZ	F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	FtsZ full length	FtsZ and SulA interact directly causing SulA to block cell division	PMID:8752322	2 hybrid screen
Protein	FtsZ2		PMID:8752322	2 hybrid screen
Protein	FtsZ ring	sulA blocks formation of FtsZ ring and leads to filamentation	PMID:8432706
edit table

</protect>

Notes

FtsZ contains a fairly strong activation domain (AD) and cannot be used as the bait in 2 hybrid screens.^[7]

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MYTSGYAHRS SSFSSAASKI ARVSTENTTA GLISEVVYRE DQPMMTQLLL LPLLQQLGQQ SRWQLWLTPQ QKLSREWVQA SGLPLTKVMQ ISQLSPCHTV ESMVRALRTG NYSVVIGWLA DDLTEEEHAE LVDAANEGNA MGFIMRPVSA SSHATRQLSG LKIHSNLYH
Length	169
Mol. Wt	18.8 kDa
pI	7.1 (calculated)
Extinction coefficient	29,450 - 29,575 (calc based on 5 Y, 4 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	2..120	PF03846 Cell division inhibitor SulA		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=sulA taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128925	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947335	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003244	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AFZ5	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10984	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10984	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947335	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000973	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0977	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	1.571+/-0.082	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.02259332	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	334	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	373	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	377	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
sulA
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1020122..1020162 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0958 (EcoliWiki Page)	NCBI GEO profiles for sulA
microarray	GenExpDB:b0958 (EcoliWiki Page)	Summary of data for sulA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1020048..1020402) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ13; Well:B12^[9]
edit table

Notes

Accessions Related to sulA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10984	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0977	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0958
EcoGene	EcoGene:EG10984	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000973	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003244	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	SULA	From SHIGELLACYC
E. coli O157	SULA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:52540
Pfam (EcoliWiki Page)	PF03846 Cell division inhibitor SulA
EcoCyc	EcoCyc:EG10984	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10984	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000973	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0977	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0003244	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Huisman, O et al. (1980) Further characterization of sfiA and sfiB mutations in Escherichia coli. J. Bacteriol. 144 185-91 PubMed
↑ ^6.0 ^6.1 ^6.2 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 Huang, J et al. (1996) Interaction between FtsZ and inhibitors of cell division. J. Bacteriol. 178 5080-5 PubMed
↑ ^8.0 ^8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

sulA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to sulA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search