sulA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
sulA |
|---|---|
| Mnemonic |
Suppressor of lon |
| Synonyms |
ECK0949, b0958, JW0941, sfiA, suf[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.98 minutes |
MG1655: 1020142..1019633 |
||
|
NC_012967: 1038010..1037501 |
||||
|
NC_012759: 922601..923110 |
||||
|
W3110 |
|
W3110: 1021341..1020832 |
||
|
DH10B: 1074070..1073561 |
||||
| edit table |
</protect>
Notes
Huisman et al. (1980) established the identity of the map location[2].
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
sulA(del) (Keio:JW0941) |
deletion |
deletion |
|||||
|
sulAL167A |
L167A |
Slight decrease in degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAH169A |
H169A |
Great decrease in degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulA::Tn5KAN-2 (FB20073) |
Insertion at nt 205 in Minus orientation |
does not contain pKD46 | |||||
|
sulAL83R |
L83R |
Loss of activity due to loss of ability to bind to ftsZ |
seeded from UniProt:P0AFZ5 | ||||
|
sulAK87A |
K87A |
Loss of degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAK72A |
K72A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR75A |
R75A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAE76A |
E76A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAH128A |
H128A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAI163A |
I163A |
Slight decrease in degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAH164A |
H164A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR108A |
R108A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAV115A |
V115A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAG117A |
G117A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAE126A |
E126A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR62C,H,S |
R62C,H,S |
Loss of activity due to loss of ability to bind to ftsZ |
seeded from UniProt:P0AFZ5 | ||||
|
sulAL67A |
L67A |
Loss of degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR39A |
R39A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR62A |
R62A |
Loss of degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAH98A |
H98A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAR105A |
R105A |
No effect on degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulAW77A |
W77A |
Loss of degradation by lon protease |
seeded from UniProt:P0AFZ5 | ||||
|
sulA1 |
|||||||
|
sulA3 |
|||||||
|
sulA27 |
|||||||
|
sulA28 |
|||||||
|
sulA211 |
Growth Phenotype |
| |||||
|
sulA22 |
|||||||
|
sulA24 |
|||||||
|
sulA2111 |
|||||||
|
sulA366 |
|||||||
|
sulA773(del)::kan |
|||||||
|
sulA |
R62S |
Loss of function |
|||||
|
sulA |
R62C |
Loss of function |
|||||
|
sulA |
R62H |
Loss of function |
|||||
|
sulA |
L83R |
Loss of function |
|||||
|
sulA |
40 |
loss of SulA production due to the stop codon introduced at position 40. | |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0941 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTACACTTCAGGCTATGCACA Primer 2:CCATGATACAAATTAGAGTGAAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 54% [11] | ||
|
Linked marker |
est. P1 cotransduction: 16% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Huisman, O et al. (1980) Further characterization of sfiA and sfiB mutations in Escherichia coli. J. Bacteriol. 144 185-91 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ George, J et al. (1975) Prophage induction and cell division in E. coli. III. Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif. Mol. Gen. Genet. 140 309-332 PubMed
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 Huang, J et al. (1996) Interaction between FtsZ and inhibitors of cell division. J. Bacteriol. 178 5080-5 PubMed
- ↑ Gottesman, S et al. (1981) Role of sulA and sulB in filamentation by lon mutants of Escherichia coli K-12. J. Bacteriol. 148 265-73 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
