ruvC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ruvC |
|---|---|
| Mnemonic |
Resistance to UV light |
| Synonyms |
ECK1864, b1863, JW1852[1], JW1852 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
41.92 minutes |
MG1655: 1945400..1944879 |
||
|
NC_012967: 1926146..1925625 |
||||
|
NC_012759: 1836938..1837459 |
||||
|
W3110 |
|
W3110: 1949090..1948569 |
||
|
DH10B: 2035971..2035450 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1944882 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔruvC (Keio:JW1852) |
deletion |
deletion |
|||||
|
ruvC::Tn5KAN-2 (FB20479) |
Insertion at nt 86 in Plus orientation |
contains pKD46 | |||||
|
ruvC53 |
Sensitivity to |
|
|||||
|
ruvC51 |
|||||||
|
ruvC67::cat |
|||||||
|
ΔruvC789::kan |
|||||||
|
ruvC53ΔtopB |
Sensitivity to |
|
|||||
|
ruvC in MDS42 |
deletion |
Sensitivity to |
increases sensitivity to Bicyclomycin |
fig. 2
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1852 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTATTATTCTCGGCATTGA Primer 2:CCACGCAGTCGCCCTCTCGCCAG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 59% [12] | ||
|
Linked marker |
est. P1 cotransduction: 13% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Iwasaki, H et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 10 4381-9 PubMed
- ↑ Dunderdale, HJ et al. () Formation and resolution of recombination intermediates by E. coli RecA and RuvC proteins. Nature 354 506-10 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 7.0 7.1 Lopez, CR et al. (2005) A role for topoisomerase III in a recombination pathway alternative to RuvABC. Mol. Microbiol. 58 80-101 PubMed
- ↑ Seigneur, M et al. (1998) RuvAB acts at arrested replication forks. Cell 95 419-30 PubMed
- ↑ Washburn, RS & Gottesman, ME (2011) Transcription termination maintains chromosome integrity. Proc. Natl. Acad. Sci. U.S.A. 108 792-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
