rusA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
rusA |
|---|---|
| Gene Synonym(s) |
ECK0541, b0550, JW0538, rus, rusA(qsr'), ybcP[1], ybcP |
| Product Desc. |
endodeoxyribonuclease RUS (Holliday junction resolvase)[2][3] |
| Product Synonyms(s) |
DLP12 prophage; endonuclease RUS[1], B0550[2][1], YbcP[2][1], RusA[2][1], Rus[2][1] , ECK0541, JW0538, rus, ybcP, b0550 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rusA |
|---|---|
| Mnemonic |
ruv suppressor |
| Synonyms |
ECK0541, b0550, JW0538, rus, rusA(qsr'), ybcP[1], ybcP |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
12.34 minutes |
MG1655: 572594..572956 |
||
|
NC_012967: 545261..545623 |
||||
|
NC_012759: 475354..475716 |
||||
|
W3110 |
|
W3110: 572594..572956 |
||
|
DH10B: 511926..512288 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
572594 |
Edman degradation |
PMID:7813450 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrusA (Keio:JW0538) |
deletion |
deletion |
PMID:16738554 |
||||
|
rusAF87Y,V |
F87Y,V |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAD90N |
D90N |
Slight reduction in ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD91N |
D91N |
Loss of ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD70N |
D70N |
Reduces junction resolution 80- fold. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD72N |
D72N |
Loss of ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAN73A |
N73A |
Slight reduction in ability to promote DNA repair. Great reduction in Holliday junction resolution activity |
seeded from UniProt:P0AG74 | ||||
|
rusAK76Q |
K76Q |
Loss of ability to promote DNA repair. Loss of Holliday junction resolvase activity. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAK76R |
K76R |
Loss of ability to promote DNA repair. Less than 2% activity of Holliday junction resolvase. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD80N |
D80N |
Slight reduction in ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAK101Q |
K101Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR58Q |
R58Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAE111Q |
E111Q |
No effect on resolvase activity or DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAR19Q |
R19Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR68Q |
R68Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR69Q,A |
R69Q,A |
Loss of ability to promote DNA repair. Great loss of Holliday junction resolvase activity. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAE116Q |
E116Q |
No effect on resolvase activity or DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAY17L |
Y17L |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR16Q |
R16Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
ΔrusA(qsr')-3::kan |
PMID:8648624 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0538 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAATACCTACAGCATCACATT Primer 2:CCTTCATTCCCCATTTCGGTGAT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 47% [5] | ||
|
Linked marker |
est. P1 cotransduction: 3% [5] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6306 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG20283 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002914 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB4170 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001880 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RusA |
|---|---|
| Synonyms |
DLP12 prophage; endonuclease RUS[1], B0550[2][1], YbcP[2][1], RusA[2][1], Rus[2][1] , ECK0541, JW0538, rus, ybcP, b0550 |
| Product description |
endodeoxyribonuclease RUS (Holliday junction resolvase)[2][3] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000287 |
magnesium ion binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008822 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000287 |
magnesium ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0460 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004518 |
nuclease activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0540 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004519 |
endonuclease activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0255 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006281 |
DNA repair |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008822 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006281 |
DNA repair |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0234 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008822 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0233 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006974 |
response to DNA damage stimulus |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0227 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008821 |
crossover junction endodeoxyribonuclease activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.1.22.4 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MNTYSITLPW PPSNNRYYRH NRGRTHVSAE GQAYRDNVAR IIKNAMLDIG LAMPVKIRIE CHMPDRRRRD LDNLQKAAFD ALTKAGFWLD DAQVVDYRVV KMPVTKGGRL ELTITEMGNE |
| Length |
120 |
| Mol. Wt |
13.845 kDa |
| pI |
10.0 (calculated) |
| Extinction coefficient |
18,450 - 18,575 (calc based on 5 Y, 2 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0001880 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:G6306 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG20283 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120002914 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4170 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
|
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
|
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:572574..572614
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rusA | |
|
microarray |
Summary of data for rusA from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to rusA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6306 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4170 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG20283 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002914 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001880 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
S2140 |
From SHIGELLACYC |
|
E. coli O157 |
RUS |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6306 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG20283 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002914 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4170 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0001880 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


