{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rusA
Gene Synonym(s)	ECK0541, b0550, JW0538, rus, rusA(qsr'), ybcP^[1], ybcP
Product Desc.	endodeoxyribonuclease RUS (Holliday junction resolvase)^[2]^[3]
Product Synonyms(s)	DLP12 prophage; endonuclease RUS^[1], B0550^[2]^[1], YbcP^[2]^[1], RusA^[2]^[1], Rus^[2]^[1] , ECK0541, JW0538, rus, ybcP, b0550
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): ybcN^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rusA
Mnemonic	ruv suppressor
Synonyms	ECK0541, b0550, JW0538, rus, rusA(qsr'), ybcP^[1], ybcP
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	12.34 minutes	MG1655: 572594..572956 <gbrowseImage> name=NC_000913:572594..572956 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 545261..545623 <gbrowseImage> name=NC_012967:545261..545623 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 475354..475716 <gbrowseImage> name=NC_012759:475354..475716 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 572594..572956 <gbrowseImage> name=NC_007779:572594..572956 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 511926..512288 <gbrowseImage> name=NC_010473:511926..512288 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	572594	Edman degradation	PMID:7813450
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
ΔrusA (Keio:JW0538)	deletion	deletion		PMID:16738554	Shigen
rusAF87Y,V		F87Y,V	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAD90N		D90N	Slight reduction in ability to resolve junctions. No effect on DNA binding			seeded from UniProt:P0AG74
rusAD91N		D91N	Loss of ability to resolve junctions. No effect on DNA binding			seeded from UniProt:P0AG74
rusAD70N		D70N	Reduces junction resolution 80- fold. No effect on DNA binding			seeded from UniProt:P0AG74
rusAD72N		D72N	Loss of ability to resolve junctions. No effect on DNA binding			seeded from UniProt:P0AG74
rusAN73A		N73A	Slight reduction in ability to promote DNA repair. Great reduction in Holliday junction resolution activity			seeded from UniProt:P0AG74
rusAK76Q		K76Q	Loss of ability to promote DNA repair. Loss of Holliday junction resolvase activity. No effect on DNA binding			seeded from UniProt:P0AG74
rusAK76R		K76R	Loss of ability to promote DNA repair. Less than 2% activity of Holliday junction resolvase. No effect on DNA binding			seeded from UniProt:P0AG74
rusAD80N		D80N	Slight reduction in ability to resolve junctions. No effect on DNA binding			seeded from UniProt:P0AG74
rusAK101Q		K101Q	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAR58Q		R58Q	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAE111Q		E111Q	No effect on resolvase activity or DNA binding			seeded from UniProt:P0AG74
rusAR19Q		R19Q	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAR68Q		R68Q	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAR69Q,A		R69Q,A	Loss of ability to promote DNA repair. Great loss of Holliday junction resolvase activity. No effect on DNA binding			seeded from UniProt:P0AG74
rusAE116Q		E116Q	No effect on resolvase activity or DNA binding			seeded from UniProt:P0AG74
rusAY17L		Y17L	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
rusAR16Q		R16Q	No effect on ability to promote DNA repair			seeded from UniProt:P0AG74
ΔrusA(qsr')-3::kan				PMID:8648624	CGSC:59112
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0538	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAATACCTACAGCATCACATT Primer 2:CCTTCATTCCCCATTTCGGTGAT
23E10	Kohara Phage	Genobase	PMID:3038334
purK79::Tn10	Linked marker	CAG12171 = CGSC7342^[4]	est. P1 cotransduction: 47% ^[5] Synonyms:purE79::Tn10
dsbG601::Tn10	Linked marker	CAG12149 = CGSC7346^[4]	est. P1 cotransduction: 3% ^[5] Synonyms:zbd-601::Tn10, zbe-601::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G6306	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG20283	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002914	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945174	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB4170	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001880	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RusA
Synonyms	DLP12 prophage; endonuclease RUS^[1], B0550^[2]^[1], YbcP^[2]^[1], RusA^[2]^[1], Rus^[2]^[1] , ECK0541, JW0538, rus, ybcP, b0550
Product description	endodeoxyribonuclease RUS (Holliday junction resolvase)^[2]^[3]
EC number (for enzymes)	3.1.22^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000287	magnesium ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008822	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000287	magnesium ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0460	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004518	nuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0540	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0255	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006281	DNA repair	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008822	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006281	DNA repair	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0234	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR008822	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006310	DNA recombination	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0233	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0227	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008821	crossover junction endodeoxyribonuclease activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:3.1.22.4	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016787	hydrolase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0378	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0479	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MNTYSITLPW PPSNNRYYRH NRGRTHVSAE GQAYRDNVAR IIKNAMLDIG LAMPVKIRIE CHMPDRRRRD LDNLQKAAFD ALTKAGFWLD DAQVVDYRVV KMPVTKGGRL ELTITEMGNE
Length	120
Mol. Wt	13.845 kDa
pI	10.0 (calculated)
Extinction coefficient	18,450 - 18,575 (calc based on 5 Y, 2 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	8..117	PF05866 Endodeoxyribonuclease RusA		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rusA taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128533	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945174	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001880	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AG74	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:G6306	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG20283	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945174	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002914	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB4170	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MG1655	0^a	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
Protein	E. coli K-12 MG1655	0^a	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
Protein	E. coli K-12 MG1655	0^a	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
ybcN
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:572574..572614 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0550 (EcoliWiki Page)	NCBI GEO profiles for rusA
microarray	GenExpDB:b0550 (EcoliWiki Page)	Summary of data for rusA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to rusA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G6306	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB4170	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0550
EcoGene	EcoGene:EG20283	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002914	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001880	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	S2140	From SHIGELLACYC
E. coli O157	RUS	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:103084
Pfam (EcoliWiki Page)	PF05866 Endodeoxyribonuclease RusA
PFAM (EcoliWiki Page)	PFAM:PF05866
EcoCyc	EcoCyc:G6306	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG20283	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002914	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB4170	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001880	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 CGSC: The Coli Genetics Stock Center
↑ ^5.0 ^5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

rusA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rusA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search