rusA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rusA |
|---|---|
| Mnemonic |
ruv suppressor |
| Synonyms |
ECK0541, b0550, JW0538, rus, rusA(qsr'), ybcP[1], ybcP |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
12.34 minutes |
MG1655: 572594..572956 |
||
|
NC_012967: 545261..545623 |
||||
|
NC_012759: 475354..475716 |
||||
|
W3110 |
|
W3110: 572594..572956 |
||
|
DH10B: 511926..512288 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
572594 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrusA (Keio:JW0538) |
deletion |
deletion |
|||||
|
rusAF87Y,V |
F87Y,V |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAD90N |
D90N |
Slight reduction in ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD91N |
D91N |
Loss of ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD70N |
D70N |
Reduces junction resolution 80- fold. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD72N |
D72N |
Loss of ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAN73A |
N73A |
Slight reduction in ability to promote DNA repair. Great reduction in Holliday junction resolution activity |
seeded from UniProt:P0AG74 | ||||
|
rusAK76Q |
K76Q |
Loss of ability to promote DNA repair. Loss of Holliday junction resolvase activity. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAK76R |
K76R |
Loss of ability to promote DNA repair. Less than 2% activity of Holliday junction resolvase. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAD80N |
D80N |
Slight reduction in ability to resolve junctions. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAK101Q |
K101Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR58Q |
R58Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAE111Q |
E111Q |
No effect on resolvase activity or DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAR19Q |
R19Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR68Q |
R68Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR69Q,A |
R69Q,A |
Loss of ability to promote DNA repair. Great loss of Holliday junction resolvase activity. No effect on DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAE116Q |
E116Q |
No effect on resolvase activity or DNA binding |
seeded from UniProt:P0AG74 | ||||
|
rusAY17L |
Y17L |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
rusAR16Q |
R16Q |
No effect on ability to promote DNA repair |
seeded from UniProt:P0AG74 | ||||
|
ΔrusA(qsr')-3::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0538 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATACCTACAGCATCACATT Primer 2:CCTTCATTCCCCATTTCGGTGAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 47% [8] | ||
|
Linked marker |
est. P1 cotransduction: 3% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Sharples, GJ et al. (1994) Processing of intermediates in recombination and DNA repair: identification of a new endonuclease that specifically cleaves Holliday junctions. EMBO J. 13 6133-42 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Mahdi, AA et al. (1996) Holliday junction resolvases encoded by homologous rusA genes in Escherichia coli K-12 and phage 82. J. Mol. Biol. 257 561-73 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
