rpoD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpoD |
|---|---|
| Mnemonic |
RNA polymerase |
| Synonyms |
ECK3057, b3067, JW3039, alt[1], alt |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
69.21 minutes |
MG1655: 3211069..3212910 |
||
|
NC_012967: 3145864..3147705 |
||||
|
NC_012759: 3098217..3100058 |
||||
|
W3110 |
|
W3110: 3211703..3213544 |
||
|
DH10B: 3308814..3310655 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3211069 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpoD800 |
Growth Phenotype |
Temperature-sensitive for growth at 42°C. |
|||||
|
rpoD2 (alt) |
R596H |
||||||
|
rpoD40 |
Growth Phenotype |
Nonsense mutation |
|||||
|
rpoD(P504L) |
P504L |
Suppresses multiple amino acid auxotrophy of relA spoT double mutant |
|||||
|
rpoD(S506F) |
S506F |
Suppresses multiple amino acid auxotrophy of relA spoT double mutant |
|||||
|
rpoD800(ts) |
deletion 329-342 |
temperature sensitive |
|||||
|
rpoD285(ts) |
deletion 329-342 |
temperature sensitive |
PMID:2841288[7] PMID:3052291[8] PMID:366614[9] PMID:6355770[10] |
||||
|
rpoD899(ts) |
temperature sensitive |
||||||
|
rpoD(K99E) |
K99E |
defective in abortive initiation | |||||
| edit table |
<protect></protect>
Notes
The Keio collection[11] lists a deletion of rpoD, which is an essential gene. The insertion in this strain is a duplication of the rpoD region.[12]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3039 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAGCAAAACCCGCAGTCACA Primer 2:CCATCGTCCAGGAAGCTACGCAG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 27% [16] | ||
|
Linked marker |
est. P1 cotransduction: 87% [16] Synonyms:zgh-3075::Tn10, zgj-3075::Tn10 | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Fujiki, H & Zurek, G (1975) The subunits of DNA-dependent RNA polymerase from E. coli: I. Amino acid analysis and primary structure of the N-terminal regions. FEBS Lett. 55 242-4 PubMed
- ↑ Hu, JC & Gross, CA (1985) Mutations in the sigma subunit of E. coli RNA polymerase which affect positive control of transcription. Mol. Gen. Genet. 199 7-13 PubMed
- ↑ Travers, AA et al. (1978) A mutation affecting the sigma subunit of RNA polymerase changes transcriptional specificity. Nature 273 354-8 PubMed
- ↑ Osawa, T & Yura, T (1980) Amber mutations in the structural gene for RNA polymerase sigma factor of Escherichia coli. Mol. Gen. Genet. 180 293-300 PubMed
- ↑ 6.0 6.1 Hernandez, VJ & Cashel, M (1995) Changes in conserved region 3 of Escherichia coli sigma 70 mediate ppGpp-dependent functions in vivo. J. Mol. Biol. 252 536-49 PubMed
- ↑ Calendar, R et al. (1988) Deletion and insertion mutations in the rpoH gene of Escherichia coli that produce functional sigma 32. J. Bacteriol. 170 3479-84 PubMed
- ↑ Helmann, JD & Chamberlin, MJ (1988) Structure and function of bacterial sigma factors. Annu. Rev. Biochem. 57 839-72 PubMed
- ↑ Harris, JD et al. (1978) Temperature-sensitive Escherichia coli mutant producing a temperature-sensitive sigma subunit of DNA-dependent RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 75 6177-81 PubMed
- ↑ Hu, JC & Gross, CA (1983) Marker rescue with plasmids bearing deletions in rpoD identifies a dispensable part of E. coli sigma factor. Mol. Gen. Genet. 191 492-8 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 CGSC: The Coli Genetics Stock Center
- ↑ 16.0 16.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
