rnhA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
rnhA |
---|---|
Gene Synonym(s) |
ECK0214, b0214, JW0204, cer, dasF, herA, rnh, sdrA, sin, G306[1][2] |
Product Desc. |
RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication[2][3] RNase HI; participates in DNA replication[4] |
Product Synonyms(s) |
ribonuclease HI, degrades RNA of DNA-RNA hybrids[1], B0214[2][1], Sin[2][1], Cer[2][1], Rnh[2][1], SdrA[2][1], HerA[2][1], DasF[2][1], RnhA[2][1] , cer, dasF, ECK0214, herA, JW0204, rnh, sdrA, sin, b0214 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
rnhA |
---|---|
Mnemonic |
RNase H |
Synonyms |
ECK0214, b0214, JW0204, cer, dasF, herA, rnh, sdrA, sin, G306[1][2] |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
5.08 minutes |
MG1655: 236002..235535 |
||
NC_012967: 238926..238459 |
||||
NC_012759: 235534..236001 |
||||
W3110 |
|
W3110: 236002..235535 |
||
DH10B: 210106..209639 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
235535 |
Edman degradation |
PMID:2171503 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
rnhA(del) (Keio:JW0204) |
deletion |
deletion |
PMID:16738554 |
||||
rnhAE48Q |
E48Q |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAD70N |
D70N |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAH124A |
H124A |
Reduces activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAN130A |
N130A |
Reduces activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAD134A |
D134A |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAD134H,N |
D134H,N |
Slight decrease of activity |
seeded from UniProt:P0A7Y4 | ||||
rnhAD10N |
D10N |
Loss of activity |
seeded from UniProt:P0A7Y4 | ||||
rnhA1 |
|||||||
rnhA733(del)::kan |
PMID:16738554 |
||||||
rnh-1 dnaA508 |
insertion |
Origin Indepedence |
rnh mutation allows oriC-independent replication |
PMID:1650909 |
See table 2. | ||
rnh-59 dnaA508 |
insertion |
Origin Indepedence |
rnh mutation allows oriC-independent replication |
PMID:1650909 |
See table 2. | ||
rnh-91 (amber) dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
PMID:1650909 |
See table 2. | ||
rnh-224 (UGA) dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
PMID:1650909 |
See table 2. | ||
rnh-339::cat dnaA508 |
insertion |
Origin Indepedence |
The mutation caused differing origins or replication. |
PMID:1650909 |
See table 2. | ||
rnh-1 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
PMID:1650909 |
The mutation conferred a decrease in RNase H activity by 10 percent. See table 3. | |||
rnh-59 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
PMID:1650909 |
The mutation conferred a decrease in RNase H activity. See table 3. | |||
rnh-91 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
PMID:1650909 |
The mutation conferred a decrease in RNase H activity. See table 3. | |||
rnh-224 recB270 |
RNase H activity |
Decreased activity of RNAse H. |
PMID:1650909 |
The mutation conferred a decrease in RNase H activity. See table 3. | |||
rnh-339::cat recB270 |
RNase H activity |
Decreased activity of RNAse H. |
PMID:1650909 |
The mutation conferred a decrease in RNase H activity. See table 3. | |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0204 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCTTAAACAGGTAGAAATTTT Primer 2:CCAACTTCAACTTGGTAGCCTGT | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 89% [6] | ||
Linked marker |
est. P1 cotransduction: 40% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000851 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0853 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000717 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
RnhA |
---|---|
Synonyms |
ribonuclease HI, degrades RNA of DNA-RNA hybrids[1], B0214[2][1], Sin[2][1], Cer[2][1], Rnh[2][1], SdrA[2][1], HerA[2][1], DasF[2][1], RnhA[2][1] , cer, dasF, ECK0214, herA, JW0204, rnh, sdrA, sin, b0214 |
Product description |
RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication[2][3] RNase HI; participates in DNA replication[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000287 |
magnesium ion binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00042 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000287 |
magnesium ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0460 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003676 |
nucleic acid binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002156 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006508 |
proteolysis |
P |
Seeded from Riley et al 2006 [1]. |
Missing: evidence, reference | ||||
GO:0003676 |
nucleic acid binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012337 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004518 |
nuclease activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0540 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004519 |
endonuclease activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0255 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004523 |
ribonuclease H activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00042 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004523 |
ribonuclease H activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002156 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004523 |
ribonuclease H activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.1.26.4 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00042 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006401 |
RNA catabolic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00042 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004523 |
ribonuclease H activity |
PMID:4572736 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0003676 |
nucleic acid binding |
PMID:4572736 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0004519 |
endonuclease activity |
PMID:4572736 |
IDA: Inferred from Direct Assay |
F |
complete | |||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
ssb |
PMID:15690043 |
Experiment(s):EBI-881230, EBI-888507 | |
Protein |
aceE |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
aceF |
PMID:15690043 |
Experiment(s):EBI-881230, EBI-888507 | |
Protein |
lpdA |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
malP |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
priA |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
recQ |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
sbcB |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
topA |
PMID:15690043 |
Experiment(s):EBI-881230, EBI-888507 | |
Protein |
topB |
PMID:15690043 |
Experiment(s):EBI-881230 | |
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpmB |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpsI |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpsN |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpsT |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
yhbY |
PMID:15690043 |
Experiment(s):EBI-888507 | |
Protein |
rpsI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsC |
PMID:19402753 |
MALDI(Z-score):22.098379 | |
Protein |
rpsT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
atpD |
PMID:19402753 |
MALDI(Z-score):27.813338 | |
Protein |
rplB |
PMID:19402753 |
MALDI(Z-score):28.480234 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
malP |
PMID:19402753 |
MALDI(Z-score):20.695516 | |
Protein |
yhbY |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
atpA |
PMID:19402753 |
MALDI(Z-score):23.243464 | |
Protein |
topB |
PMID:19402753 |
LCMS(ID Probability):98.0 MALDI(Z-score):26.888562 | |
Protein |
topA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):29.004003 | |
Protein |
atpG |
PMID:19402753 |
MALDI(Z-score):39.018288 | |
Protein |
priA |
PMID:19402753 |
MALDI(Z-score):17.400508 | |
Protein |
ssb |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):6.393986 | |
Protein |
recQ |
PMID:19402753 |
MALDI(Z-score):27.556410 | |
Protein |
sbcB |
PMID:19402753 |
MALDI(Z-score):18.452946 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MLKQVEIFTD GSCLGNPGPG GYGAILRYRG REKTFSAGYT RTTNNRMELM AAIVALEALK EHCEVILSTD SQYVRQGITQ WIHNWKKRGW KTADKKPVKN VDLWQRLDAA LGQHQIKWEW VKGHAGHPEN ERCDELARAA AMNPTLEDTG YQVEV |
Length |
155 |
Mol. Wt |
17.596 kDa |
pI |
8.4 (calculated) |
Extinction coefficient |
40,450 - 40,825 (calc based on 5 Y, 6 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0000717 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000851 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0853 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
804 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
175 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
313 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:235982..236022
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for rnhA | |
microarray |
Summary of data for rnhA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (235927..236085) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to rnhA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0853 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000851 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000717 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Apis mellifera |
|
From Inparanoid:20070104 |
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
Canis familiaris |
|
From Inparanoid:20070104 |
Danio rerio |
|
From Inparanoid:20070104 |
Drosophila melanogaster |
|
From Inparanoid:20070104 |
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
Gallus gallus |
|
From Inparanoid:20070104 |
Homo sapiens |
|
From Inparanoid:20070104 |
Macaca mulatta |
|
From Inparanoid:20070104 |
Monodelphis domestica |
|
From Inparanoid:20070104 |
Mus musculus |
|
From Inparanoid:20070104 |
Pan troglodytes |
|
From Inparanoid:20070104 |
Rattus norvegicus |
|
From Inparanoid:20070104 |
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
Takifugu rubripes |
|
From Inparanoid:20070104 |
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
RNHA |
From SHIGELLACYC |
E. coli O157 |
RNHA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10860 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000851 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0853 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000717 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Danio rerio
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157