{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rnhA
Gene Synonym(s)	ECK0214, b0214, JW0204, cer, dasF, herA, rnh, sdrA, sin, G306^[1]^[2]
Product Desc.	RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication^[2]^[3] RNase HI; participates in DNA replication^[4]
Product Synonyms(s)	ribonuclease HI, degrades RNA of DNA-RNA hybrids^[1], B0214^[2]^[1], Sin^[2]^[1], Cer^[2]^[1], Rnh^[2]^[1], SdrA^[2]^[1], HerA^[2]^[1], DasF^[2]^[1], RnhA^[2]^[1] , cer, dasF, ECK0214, herA, JW0204, rnh, sdrA, sin, b0214
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rnhA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rnhA
Mnemonic	RNase H
Synonyms	ECK0214, b0214, JW0204, cer, dasF, herA, rnh, sdrA, sin, G306^[1]^[2]
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	5.08 minutes	MG1655: 236002..235535 <gbrowseImage> name=NC_000913:235535..236002 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 238926..238459 <gbrowseImage> name=NC_012967:238459..238926 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 235534..236001 <gbrowseImage> name=NC_012759:235534..236001 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 236002..235535 <gbrowseImage> name=NC_007779:235535..236002 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 210106..209639 <gbrowseImage> name=NC_010473:209639..210106 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	235535	Edman degradation	PMID:2171503
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
rnhA(del) (Keio:JW0204)	deletion	deletion			PMID:16738554	Shigen CGSC8444^[5]
rnhAE48Q		E48Q		Loss of activity			seeded from UniProt:P0A7Y4
rnhAD70N		D70N		Loss of activity			seeded from UniProt:P0A7Y4
rnhAH124A		H124A		Reduces activity			seeded from UniProt:P0A7Y4
rnhAN130A		N130A		Reduces activity			seeded from UniProt:P0A7Y4
rnhAD134A		D134A		Loss of activity			seeded from UniProt:P0A7Y4
rnhAD134H,N		D134H,N		Slight decrease of activity			seeded from UniProt:P0A7Y4
rnhAD10N		D10N		Loss of activity			seeded from UniProt:P0A7Y4
rnhA1						CGSC:8712
rnhA733(del)::kan					PMID:16738554	CGSC:102750
rnh-1 dnaA508	insertion		Origin Indepedence	rnh mutation allows oriC-independent replication	PMID:1650909	CGSC1157^[5]	See table 2.
rnh-59 dnaA508	insertion		Origin Indepedence	rnh mutation allows oriC-independent replication	PMID:1650909	CGSC1157^[5]	See table 2.
rnh-91 (amber) dnaA508	insertion		Origin Indepedence	The mutation caused differing origins or replication.	PMID:1650909	CGSC1157^[5]	See table 2.
rnh-224 (UGA) dnaA508	insertion		Origin Indepedence	The mutation caused differing origins or replication.	PMID:1650909	CGSC1157^[5]	See table 2.
rnh-339::cat dnaA508	insertion		Origin Indepedence	The mutation caused differing origins or replication.	PMID:1650909	CGSC1157^[5]	See table 2.
rnh-1 recB270			RNase H activity	Decreased activity of RNAse H.	PMID:1650909		The mutation conferred a decrease in RNase H activity by 10 percent. See table 3.
rnh-59 recB270			RNase H activity	Decreased activity of RNAse H.	PMID:1650909		The mutation conferred a decrease in RNase H activity. See table 3.
rnh-91 recB270			RNase H activity	Decreased activity of RNAse H.	PMID:1650909		The mutation conferred a decrease in RNase H activity. See table 3.
rnh-224 recB270			RNase H activity	Decreased activity of RNAse H.	PMID:1650909		The mutation conferred a decrease in RNase H activity. See table 3.
rnh-339::cat recB270			RNase H activity	Decreased activity of RNAse H.	PMID:1650909		The mutation conferred a decrease in RNase H activity. See table 3.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0204	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCTTAAACAGGTAGAAATTTT Primer 2:CCAACTTCAACTTGGTAGCCTGT
7D5	Kohara Phage	Genobase	PMID:3038334
4A11	Kohara Phage	Genobase	PMID:3038334
yafC502::Tn10	Linked marker	CAG18436 = CGSC7328^[5]	est. P1 cotransduction: 89% ^[6] Synonyms:zae-502::Tn10
proA81::Tn10	Linked marker	CAG18447 = CGSC7330^[5]	est. P1 cotransduction: 40% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10860	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10860	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946955	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000851	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0853	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000717	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RnhA
Synonyms	ribonuclease HI, degrades RNA of DNA-RNA hybrids^[1], B0214^[2]^[1], Sin^[2]^[1], Cer^[2]^[1], Rnh^[2]^[1], SdrA^[2]^[1], HerA^[2]^[1], DasF^[2]^[1], RnhA^[2]^[1] , cer, dasF, ECK0214, herA, JW0204, rnh, sdrA, sin, b0214
Product description	RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication^[2]^[3] RNase HI; participates in DNA replication^[4]
EC number (for enzymes)	3.1.26.4^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000287	magnesium ion binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00042	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000287	magnesium ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0460	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003676	nucleic acid binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002156	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006508	proteolysis				P	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0003676	nucleic acid binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR012337	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004518	nuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0540	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0255	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004523	ribonuclease H activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00042	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004523	ribonuclease H activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002156	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004523	ribonuclease H activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:3.1.26.4	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00042	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006401	RNA catabolic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00042	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016787	hydrolase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0378	F	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0479	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004523	ribonuclease H activity	PMID:4572736^[7]	IDA: Inferred from Direct Assay		F		complete
	GO:0003676	nucleic acid binding	PMID:4572736^[7]	IDA: Inferred from Direct Assay		F		complete
	GO:0004519	endonuclease activity	PMID:4572736^[7]	IDA: Inferred from Direct Assay		F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	ssb	PMID:15690043^[8]	Experiment(s):EBI-881230, EBI-888507
Protein	aceE	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	aceF	PMID:15690043^[8]	Experiment(s):EBI-881230, EBI-888507
Protein	lpdA	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	malP	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	priA	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	recQ	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	rplB	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	rpsC	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	sbcB	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	topA	PMID:15690043^[8]	Experiment(s):EBI-881230, EBI-888507
Protein	topB	PMID:15690043^[8]	Experiment(s):EBI-881230
Protein	hupA	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpmB	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpsE	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpsI	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpsN	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpsT	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	yhbY	PMID:15690043^[8]	Experiment(s):EBI-888507
Protein	rpsI	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsC	PMID:19402753^[9]	MALDI(Z-score):22.098379
Protein	rpsT	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsN	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	atpD	PMID:19402753^[9]	MALDI(Z-score):27.813338
Protein	rplB	PMID:19402753^[9]	MALDI(Z-score):28.480234
Protein	hupA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	malP	PMID:19402753^[9]	MALDI(Z-score):20.695516
Protein	yhbY	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpmB	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	atpA	PMID:19402753^[9]	MALDI(Z-score):23.243464
Protein	topB	PMID:19402753^[9]	LCMS(ID Probability):98.0 MALDI(Z-score):26.888562
Protein	topA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):29.004003
Protein	atpG	PMID:19402753^[9]	MALDI(Z-score):39.018288
Protein	priA	PMID:19402753^[9]	MALDI(Z-score):17.400508
Protein	ssb	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):6.393986
Protein	recQ	PMID:19402753^[9]	MALDI(Z-score):27.556410
Protein	sbcB	PMID:19402753^[9]	MALDI(Z-score):18.452946
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MLKQVEIFTD GSCLGNPGPG GYGAILRYRG REKTFSAGYT RTTNNRMELM AAIVALEALK EHCEVILSTD SQYVRQGITQ WIHNWKKRGW KTADKKPVKN VDLWQRLDAA LGQHQIKWEW VKGHAGHPEN ERCDELARAA AMNPTLEDTG YQVEV
Length	155
Mol. Wt	17.596 kDa
pI	8.4 (calculated)
Extinction coefficient	40,450 - 40,825 (calc based on 5 Y, 6 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	2..142	PF00075 RNase H		PMID:19920124^[10]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rnhA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128201	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946955	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000717	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A7Y4	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10860	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10860	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946955	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000851	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0853	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	804	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	175	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	313	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rnhA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:235982..236022 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0214 (EcoliWiki Page)	NCBI GEO profiles for rnhA
microarray	GenExpDB:b0214 (EcoliWiki Page)	Summary of data for rnhA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (235927..236085) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ13; Well:A2^[11]
edit table

Notes

Accessions Related to rnhA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10860	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0853	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0214
EcoGene	EcoGene:EG10860	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000851	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000717	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000014694 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000020799 (score: 1.000; bootstrap: 100%) ENSAPMP00000031455 (score: 0.775)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00031618 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00019088 (score: 1.000; bootstrap: 85%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000004840 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040718-407 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040718-448 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0023171 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA21286-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000026388 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000313350 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000019005 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000018108 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:1335073 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000019974 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000011819 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPBC3366c (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000131271 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00020247001 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000002604 (score: 1.000; bootstrap: 90%)	From Inparanoid:20070104
Shigella flexneri	RNHA	From SHIGELLACYC
E. coli O157	RNHA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:53098
Panther (EcoliWiki Page)	PTHR10642:SF0
Pfam (EcoliWiki Page)	PF00075 RNase H
EcoCyc	EcoCyc:EG10860	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10860	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000851	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0853	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000717	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 ^1.14 ^1.15 ^1.16 ^1.17 ^1.18 ^1.19 ^1.20 ^1.21 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 ^2.16 ^2.17 ^2.18 ^2.19 ^2.20 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 ^5.3 ^5.4 ^5.5 ^5.6 ^5.7 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.0 ^7.1 ^7.2 Miller, HI et al. (1973) Ribonuclease H (hybrid) in Escherichia coli. Identification and characterization. J. Biol. Chem. 248 2621-4 PubMed
↑ ^8.00 ^8.01 ^8.02 ^8.03 ^8.04 ^8.05 ^8.06 ^8.07 ^8.08 ^8.09 ^8.10 ^8.11 ^8.12 ^8.13 ^8.14 ^8.15 ^8.16 ^8.17 ^8.18 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

rnhA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rnhA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search